Optimization of CRISPR/Cas12a System and Development of It-mediated Adenine Base Editor in Rice

doi:10.13560/j.cnki.biotech.bull.1985.2021-0231

Abstract

Abstract:

In order to develop an efficient CRISPR/Cas12a-mediated gene editing system in rice,different Cas12a homologous proteins and crRNA configurations and lengths were tested to explore the factors affecting the editing activity of Cas12a. We found that LbCas12a had a high editing efficiency with crRNA 23 nt compared with AsCas12a,and the U₄AU₄ sequence at the 3' end of crRNA didn’t enhanced its editing activity. Meanwhile,we fused the Escherichia coli adenine deaminase variant TadA8e to develop the CRISPR/LbCas12a-mediated adenine base editing system pUbi∶rBE58,which successfully induced the conversion A to G at the target loci in rice endogenous gene OsCPK15,with an efficiency of 33.33%. Our results demonstrate that using CRISPR/Cas12a-mediated may genetically edit the genes of rice,and this enriches rice gene editing tools and broadens gene editing toolkits.

Key words: CRISPR, Cas12a, adenine base editor, Oryza sativa

WANG Jing-wen, YAN Fang, LIU Lang, ZHOU Xue-ping, WANG Dao-wen, ZHOU Huan-bin. Optimization of CRISPR/Cas12a System and Development of It-mediated Adenine Base Editor in Rice[J]. Biotechnology Bulletin, 2021, 37(6): 279-285.

Figures/Tables 6

Table 1 Plasmids and strains involved in this study

	Name	Source
Plasmid	pUC57:LbCas12a-crRNA	Bought from Sangon Biotech
	pUC57:AsCas12a-crRNA	Bought from Sangon Biotech
	pUC57:LbCas12a	Bought from Sangon Biotech
	pUC57:AsCas12a	Bought from Sangon Biotech
	pENTR4	Lab stock
	pHZ11	This study
	pHZ4	This study
	pUC19:rBE3	Lab stock
	pUC19:LbCas12a	This study
	pUC19:AsCas12a	This study
	pUbi:rBE3	Lab stock
	pUbi:LbCas12a	This study
	pUbi:AsCas12a	This study
	pUbi:rBE58	This study
Strain	JM109	Lab stock
	DB3.1	Lab stock
	EHA105	Lab stock

Fig.1 Schematics of gene editing constructs A:Schematics of Cas12a expression components. B:Schematics of crRNA vector. C:Schematics of the adenine base editor(pUbi:rBE58)

Fig.2 Detection of CRISPR/LbCas12a in rice protoplasts and the nuclease activity of CRISPR/AsCas12a A:PCR/RE detection of editing OsCERK1 gene in the rice protoplasts mediated by CRISPR/AsCas12a system. B:PCR/RE detection of editing OsCERK1 gene in the rice protoplasts mediated by CRISPR/LbCas12a system

Table 2 Target sites used in this study

Gene name	Target site sequence
OsCERK1	AGGAGGCCCTCAACTCGCCGGAT
OsCPK13	ATGGGCAACGCATGCGGCGGTTC
OsCPK17	ATAGGATCGTGCAGCGCGGGCAC
OsCPK15	CACCACTAGATATAGAAGGCCAT
Bsrd1	AATTTTAACTGATAAATATAAGT
OsJAZ4	AGGACGAGATCATGGAGTCTGAC

Fig.3 Comparison of nuclease activities of AsCas12a and LbCas12a with different crRNA configurations

Fig.4 Targeted adenine base editing of endogenous gene OsCPK15 in rice using the rBE58 system A:Various editing types of target site OsCPK15 generated by rBE58,target sequences,PAM sequences,targeted base T in the putative editing window,and detected A-to-G conversions are highlighted in bold,green,red,and blue,respectively;and the detected mutated nucleotide in the figure are indicated by the red underlines. B:Summary of target base editing efficiency in the activity window of base editing for the target sites ofOsCPK15 gene mediated by rBE58

References 22

[1]	Makarova KS, Koonin EV. Annotation and classification of CRISPR-cas systems[J]. Methods Mol Biol, 2015, 1311:47-75.
[2]	Koonin EV, Makarova KS, Zhang F. Diversity, classification and evolution of CRISPR-Cas systems[J]. Curr Opin Microbiol, 2017, 37:67-78. doi: 10.1016/j.mib.2017.05.008 URL
[3]	Makarova KS, Wolf YI, Iranzo J, et al. Evolutionary classification of CRISPR-Cas systems:a burst of class 2 and derived variants[J]. Nat Rev Microbiol, 2020, 18(2):67-83. doi: 10.1038/s41579-019-0299-x URL
[4]	Jinek M, Chylinski K, Fonfara I, et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity[J]. Science, 2012, 337(6096):816-821. doi: 10.1126/science.1225829 URL
[5]	Zetsche B, Gootenberg JS, Abudayyeh OO, et al. Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system[J]. Cell, 2015, 163(3):759-771. doi: 10.1016/j.cell.2015.09.038 pmid: 26422227
[6]	Strecker J, Jones S, Koopal B, et al. Engineering of CRISPR-Cas12b for human genome editing[J]. Nat Commun, 2019, 10(1):212. doi: 10.1038/s41467-018-08224-4 URL
[7]	Zetsche B, Heidenreich M, Mohanraju P, et al. Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array[J]. Nat Biotechnol, 2017, 35(1):31-34. doi: 10.1038/nbt.3737 pmid: 27918548
[8]	Hur JK, Kim K, Been KW, et al. Targeted mutagenesis in mice by electroporation of Cpf1 ribonucleoproteins[J]. Nat Biotechnol, 2016, 34(8):807-808. doi: 10.1038/nbt.3596 URL
[9]	Endo A, Masafumi M, Kaya H, et al. Efficient targeted mutagenesis of rice and tobacco genomes using Cpf1 from Francisella novicida[J]. Sci Rep, 2016, 6:38169. doi: 10.1038/srep38169 URL
[10]	Tang X, Lowder LG, Zhang T, et al. A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants[J]. Nat Plants, 2017, 3:17018. doi: 10.1038/nplants.2017.18 pmid: 28211909
[11]	Wang M, Mao Y, Lu Y, et al. Multiplex gene editing in rice using the CRISPR-Cpf1 system[J]. Mol Plant, 2017, 7:1011-1013.
[12]	Kim H, Kim ST, Ryu J, et al. CRISPR/Cpf1-mediated DNA-free plant genome editing[J]. Nat Commun, 2017, 8:14406. doi: 10.1038/ncomms14406 URL
[13]	Kim D, Lim K, Kim ST, et al. Genome-wide target specificities of CRISPR RNA-guided programmable deaminases[J]. Nat Biotechnol, 2017, 35(5):475-480. doi: 10.1038/nbt.3852 URL
[14]	Van Vu T, Sivankalyani V, Kim EJ, et al. Homology-directed repair using next-generation CRISPR/Cpf1-geminiviral replicons in tomato[J]. bioRxiv, 2019: 521419.
[15]	Malzahn AA, Tang X, Lee K, et al. Application of CRISPR-Cas12a temperature sensitivity for improved genome editing in rice, maize, and Arabidopsis[J]. BMC Biol, 2019, 17(1):9. doi: 10.1186/s12915-019-0629-5 pmid: 30704461
[16]	Li J, Xu R, Qin R, et al. Genome editing mediated by SpCas9 variants with broad non-canonical PAM compatibility in plants[J]. Mol Plant, 2021, 14(2):352-360. doi: 10.1016/j.molp.2020.12.017 URL
[17]	Zhou H, Liu B, Weeks DP, et al. Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice[J]. Nucleic Acids Res, 2014, 42(17):10903-10914. doi: 10.1093/nar/gku806 URL
[18]	Ren B, Yan F, Kuang YJ, et al. A CRISPR/Cas9 toolkit for efficient targeted base editing to induce genetic variations in rice[J]. Sci China Life Sci, 2017, 60(5):516-519. doi: 10.1007/s11427-016-0406-x URL
[19]	Jiang W, Zhou H, Bi H, et al. Demonstration of CRISPR/Cas9/sgRNA-mediated targeted gene modification in Arabidopsis, tobacco, Sorghum and rice[J]. Nucleic Acids Res, 2013, 41(20):e188. doi: 10.1093/nar/gkt780 URL
[20]	Hiei Y, Ohta S, Komari T, et al. Efficient transformation of rice(Oryza sativa L.)mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA[J]. The Plant Journal, 1994, 6(2):271-282. doi: 10.1046/j.1365-313X.1994.6020271.x URL
[21]	Moon SB, Lee JM, Kang JG, et al. Highly efficient genome editing by CRISPR-Cpf1 using CRISPR RNA with a uridinylate-rich 3'-overhang[J]. Nat Commun, 2018, 9(1):3651. doi: 10.1038/s41467-018-06129-w pmid: 30194297
[22]	Li X, Wang Y, Liu Y, et al. Base editing with a Cpf1-cytidine deaminase fusion[J]. Nat Biotechnol, 2018, 36(4):324-327. doi: 10.1038/nbt.4102 URL