Identification and Gene Functional Analysis of Salinity-hypersensitive Mutant ss2 in Rice

doi:10.13560/j.cnki.biotech.bull.1985.2021-1444

Abstract

Abstract:

A library of ethane methyl sulfonate-induced Japonica rice mutants was screened under salinity conditions to explore putative salt stress-responsive genes,and a particularly salinity-sensitive mutant was identified. When challenged with 100 mmol/L NaCl,the mutant wilted heavily,became chlorotic and took up substantially more Na⁺ into shoots than its wild type（WT）. The mutant plants' leaves suffered from a significantly greater decrease in both photosynthetic rate and leaf chlorophyll content than the WT plants' leaves after exposure to salinity,while the sucrose contents of the leaves increased and that in the roots decreased to 83% of WT ones. The expressions of several genes involved in sugar transport in the source leaves were down-regulated, indicating the impairment of sugar partitioning to the roots of the tissue organs. The lower sucrose contents in the sink tissues of the mutant could not meet the carbohydrate demands of plant growth,thereby the salinity tolerance reduced. The candidate gene was identified by map-based cloning and was denoted here as SS2（salinity sensitive 2）. Functional complementation using the WT restored the salt sensitivity of the mutants. There was no significant difference between the performance of the complementary transgenic lines and the WT plants grown under salinity stress. The conclusion is that SS2 plays an important role in seedling growth and the response of rice to salinity stress by influencing sugar transport.

Key words: rice, mutant, map-based cloning, sucrose transport, salinity stress

CHEN Guang, LI Jia, DU Rui-ying, WANG Xu. Identification and Gene Functional Analysis of Salinity-hypersensitive Mutant ss2 in Rice[J]. Biotechnology Bulletin, 2022, 38(9): 158-166.

Figures/Tables 8

Table 1 Primer sequences used for RT-qPCR assays

基因名称 Gene name	正向引物 Forward primer（5'-3'）	反向引物 Reverse primer（5'-3'）
UBQ5	CTCGCCGACTACAACATCCA	TCTTGGGCTTGGTGTACGTCTT
OsSUT4	CGCCGGCGGTGGCGGCCTCA	CGTGAGGAGCGAGAGCTGA
OsSWEET11	GACGTTCTTGCAGGTGTACA	TAGCGGACGATGTAGGCGGC
OsSWEET14	TTCCCAACGTGCTGGGCTTCT	GCACCTCGCGGGTCTTGACG
OsMT	GCTGCCAGGCAGGAAGCT	GGTTCCAGTTTCACCACGACA

Table 2 Marked primer used for gene mapping

标记 Marker	正向引物 Forward primer（5'-3'）	反向引物 Reverse primer（5'-3'）
SS11	GCAACTGGTGGAGTCTATTT	CATGCTAACATGAGGTGATC
SS12	ACGCCTCCCAAGTCGAAAGG	GGTGGGCCTCGATTGTAAGTAG
SS10	TTGGCTCTTCTCCTTAGTAT	CATTTGTATCTTGTGAACGT
SS3	CCAATGTTTGCTCCAGAT	TTCAATGACCCACGTCCC
SS4	TGGTTTTCCTTGTTGCTG	GCTTGCGGCTCTGCTTAC
SS20	TACAGGTATGCTGCTTTTCC	CTGGTCCTTTTCATTCTAAC
SS21	AAAACATGCTCCAACAGCCT	CCAAATGTAGCCAGTGAGGA
SS22	GGAGGAGTTCATTTGAGGCG	CTGGGTGGGCTAGGAAGTAA
SS23	ATACCTCCTTGTATTCGCACT	CGATCGATTGCCACATTATA
SS24	AGCGTGAATCTAATAGCACT	CGTTCAACAAGACCCAATAC
SS25	TTGTAACCGTCGATTTCGTTC	CCGCTCCGTCACTCTACTACC
SS16	CCTCCGACCTCAGCACCTGC	GTTGGCGTCCGCTGCTCCTG
SS17	AGGTAGGCGTGGCGATCAAC	CTTCTCCGGTCACCATCCAC
SS27	TTGGCGATTAATGATCCGGGAAC	CGTTCGTGCCGGTGATGTCG
SS29	ACAACAGTTCTTCACCAGAG	GTAGTATAAATTGTAATAGCTCAA
SS32	GTTAAATGAATCATCAGGAT	AGTAGTCTTGAATTCGCTGT

Fig.1 Effects of SS2 mutation on the growth performance of seedlings under normal and salinity stress A：Growth performance of WT and ss2 mutants seedling under normal or NaCl treatment. Yellow bar = 1 cm. White bar = 5 cm. B-E：Shoot height（B）,shoot fresh weight（C）,Na+ concentration（[Na]）（D）and[Na]/[K]ratio in the shoots（E）of the ss2 mutants under normal and salinity stress conditions. The values are means ± SE of 5 replicates. Significant differences at P < 0.05 are indicated with different letters,the same below. DW：Dry weight

Fig. 2 Physiological responses of WT and ss2 to salinity stress during tillering stage A：Total chlorophyll content. B：Net photosynthetic rate of the leaf. FW：Fresh weight,the same below

Fig. 3 Comparison of sucrose transportation between WT and ss2 in response to salinity stress A：Sucrose contents of the leaf. B：Sucrose content of the root. C：Rate of sucrose export from the leaf（SER）

Fig.4 Effects of SS2 mutation on the expressions of genes related to sugar transport in WT and ss2 leaves The genes assayed were OsSUT4（A）,OsSWEET11（B）,OsSWEET14（C）and OsMT（D）. UBQ5 was chosen as the reference sequence. The expression of to-be-detected genes in non-stressed WT plants was set to 1

Fig.5 Map-based cloning of SS2 A：SS2 was primarily mapped on chromosome 5 and fine mapping with the markers developed based on the sequence of BAC clone OSJNBa0057L21. B：The SS2 locus was narrowed to a 55 kb genomic DNA region between markers SS23 and SS24. Eleven open reading frames were located in the region. C：Gene structure of the SS2 candidate LOC_Os10g41780. Arrows show mutation sites of ss2

Fig.6 Difference analysis in the growth performance of complementary transgenic plant compared with WT in response to salinity stress A：Growth performance of WT and complementary transgenic plants under normal or 100 mmol/L NaCl treatment. Yellow bar = 1 cm. White bar = 5 cm. B-E：Shoot biomass（B）,root biomass（C）,H2O2（D）and MDA（E）content in the shoots of the seedlings under normal and salinity stress conditions

References 32

[1]	Campbell MT, Bandillo N, Al Shiblawi FRA, et al. Allelic variants of OsHKT1;1 underlie the divergence between indica and japonica subspecies of rice(Oryza sativa)for root sodium content[J]. PLoS Genet, 2017, 13(6):e1006823. doi: 10.1371/journal.pgen.1006823 URL
[2]	Khan I, Khan S, Zhang Y, et al. CRISPR-Cas technology based genome editing for modification of salinity stress tolerance responses in rice(Oryza sativa L.)[J]. Mol Biol Rep, 2021, 48(4):3605-3615. doi: 10.1007/s11033-021-06375-0 URL
[3]	Machado R, Serralheiro R. Soil salinity:effect on vegetable crop growth. Management practices to prevent and mitigate soil salinization[J]. Horticulturae, 2017, 3(2):30. doi: 10.3390/horticulturae3020030 URL
[4]	Qin H, Li YX, Huang RF. Advances and challenges in the breeding of salt-tolerant rice[J]. Int J Mol Sci, 2020, 21(21):8385. doi: 10.3390/ijms21218385 URL
[5]	刘奕媺, 于洋, 方军. 盐碱胁迫及植物耐盐碱分子机制研究[J]. 土壤与作物, 2018, 7(2):201-211.
	Liu YM, Yu Y, Fang J. Saline-alkali stress and molecular mechanism of saline-alkali tolerance in plants[J]. Soils Crops, 2018, 7(2):201-211.
[6]	Lim JD, Cho JI, Park YI, et al. Sucrose transport from source to sink seeds in rice[J]. Physiol Plant, 2006, 126(4):572-584. doi: 10.1111/j.1399-3054.2006.00654.x URL
[7]	Eom JS, Choi SB, Ward JM, et al. The mechanism of phloem loading in rice(Oryza sativa)[J]. Mol Cells, 2012, 33(5):431-438. doi: 10.1007/s10059-012-0071-9 URL
[8]	Kerepesi I, Galiba G. Osmotic and salt stress-induced alteration in soluble carbohydrate content in wheat seedlings[J]. Crop Sci, 2000, 40(2):482-487. doi: 10.2135/cropsci2000.402482x URL
[9]	Watanabe S, Kojima K, Ide Y, et al. Effects of saline and osmotic stress on proline and sugar accumulation in Populus euphratica in vitro[J]. Plant Cell Tissue Organ Cult, 2000, 63(3):199-206. doi: 10.1023/A:1010619503680 URL
[10]	Feng G, Zhang FS, Li XL, et al. Improved tolerance of maize plants to salt stress by arbuscular mycorrhiza is related to higher accumulation of soluble sugars in roots[J]. Mycorrhiza, 2002, 12(4):185-190. pmid: 12189473
[11]	Mathan J, Singh A, Ranjan A. Sucrose transport in response to drought and salt stress involves ABA-mediated induction of OsSWEET13 and OsSWEET15 in rice[J]. Physiol Plant, 2021, 171(4):620-637. doi: 10.1111/ppl.13210 URL
[12]	Chen G, Feng HM, Hu QD, et al. Improving rice tolerance to potassium deficiency by enhancing OsHAK16p:WOX11-controlled root development[J]. Plant Biotechnol J, 2015, 13(6):833-848. doi: 10.1111/pbi.12320 URL
[13]	Chen G, Liu CL, Gao ZY, et al. Variation in the abundance of OsHAK1 transcript underlies the differential salinity tolerance of an indica and a japonica rice cultivar[J]. Front Plant Sci, 2018, 8:2216. doi: 10.3389/fpls.2017.02216 URL
[14]	Chen G, Liu CL, Gao ZY, et al. OsHAK1, a high-affinity potassium transporter, positively regulates responses to drought stress in rice[J]. Front Plant Sci, 2017, 8:1885. doi: 10.3389/fpls.2017.01885 pmid: 29163608
[15]	Chen G, Hu J, Dong LL, et al. The tolerance of salinity in rice requires the presence of a functional copy of FLN2[J]. Biomolecules, 2019, 10(1):17. doi: 10.3390/biom10010017 URL
[16]	Chen G, Wu C, He L, et al. Knocking out the gene RLS1 induces hypersensitivity to oxidative stress and premature leaf senescence in rice[J]. Int J Mol Sci, 2018, 19(10):2853. doi: 10.3390/ijms19102853 URL
[17]	Chen G, Hu J, Lian J, et al. Functional characterization of OsHAK1 promoter in response to osmotic/drought stress by deletion analysis in transgenic rice[J]. Plant Growth Regul, 2019, 88(3):241-251. doi: 10.1007/s10725-019-00504-3 URL
[18]	Lee S, Kim JH, Yoo ES, et al. Differential regulation of chlorophyll a oxygenase genes in rice[J]. Plant Mol Biol, 2005, 57(6):805-818. pmid: 15952067
[19]	Yang YL, Xu J, Huang LC, et al. PGL, encoding chlorophyllide a oxygenase 1, impacts leaf senescence and indirectly affects grain yield and quality in rice[J]. J Exp Bot, 2016, 67(5):1297-1310. doi: 10.1093/jxb/erv529 pmid: 26709310
[20]	Ferrandino A, Lovisolo C. Abiotic stress effects on grapevine(Vitis vinifera L.):focus on abscisic acid-mediated consequences on secondary metabolism and berry quality[J]. Environ Exp Bot, 2014, 103:138-147. doi: 10.1016/j.envexpbot.2013.10.012 URL
[21]	Aoki N, Hirose T, Scofield GN, et al. The sucrose transporter gene family in rice[J]. Plant Cell Physiol, 2003, 44(3):223-232. pmid: 12668768
[22]	Gong X, Liu ML, Zhang LJ, et al. Arabidopsis AtSUC2 and AtSUC4, encoding sucrose transporters, are required for abiotic stress tolerance in an ABA-dependent pathway[J]. Physiol Plant, 2015, 153(1):119-136. doi: 10.1111/ppl.12225 pmid: 24814155
[23]	Jia WQ, Zhang LJ, Wu D, et al. Sucrose transporter AtSUC9 mediated by a low sucrose level is involved in Arabidopsis abiotic stress resistance by regulating sucrose distribution and ABA accumulation[J]. Plant Cell Physiol, 2015, 56(8):1574-1587. doi: 10.1093/pcp/pcv082 URL
[24]	Ma QJ, Sun MH, Kang H, et al. A CIPK protein kinase targets sucrose transporter MdSUT2. 2 at Ser²⁵⁴ for phosphorylation to enhance salt tolerance[J]. Plant Cell Environ, 2019, 42(3):918-930. doi: 10.1111/pce.13349 URL
[25]	Ma QJ, Sun MH, Lu J, et al. An apple sucrose transporter MdSUT2.2is a phosphorylation target for protein kinase MdCIPK22 in response to drought[J]. Plant Biotechnol J, 2019, 17(3):625-637. doi: 10.1111/pbi.13003 URL
[26]	Ibraheem O, Dealtry G, Roux S, et al. The effect of drought and salinity on the expressional levels of sucrose transporters in rice(Oryza sativa Nipponbare)cultivar plants[J]. Plant Omics, 2011, 4(2):68-74.
[27]	Siahpoosh MR, Sanchez DH, Schlereth A, et al. Modification of OsSUT1 gene expression modulates the salt response of rice Oryza sativa cv. Taipei 309[J]. Plant Sci, 2012, 182:101-111. doi: 10.1016/j.plantsci.2011.01.001 pmid: 22118621
[28]	Zhou AM, Ma HP, Feng S, et al. A novel sugar transporter from Dianthus spiculifolius, DsSWEET12, affects sugar metabolism and confers osmotic and oxidative stress tolerance in Arabidopsis[J]. Int J Mol Sci, 2018, 19(2):497. doi: 10.3390/ijms19020497 URL
[29]	Zhou AM, Ma HP, Feng S, et al. DsSWEET17, a tonoplast-localized sugar transporter from Dianthus spiculifolius, affects sugar metabolism and confers multiple stress tolerance in Arabidopsis[J]. Int J Mol Sci, 2018, 19(6):1564. doi: 10.3390/ijms19061564 URL
[30]	Platten JD, Egdane JA, Ismail AM. Salinity tolerance, Na⁺ exclusion and allele mining of HKT1;5 in Oryza sativa and O. glaberrima:many sources, many genes, one mechanism?[J]. BMC Plant Biol, 2013, 13:32. doi: 10.1186/1471-2229-13-32 pmid: 23445750
[31]	Yeo AR, Yeo ME, Flowers SA, et al. Screening of rice(Oryza sativa L.)genotypes for physiological characters contributing to salinity resistance, and their relationship to overall performance[J]. Theor Appl Genet, 1990, 79(3):377-384. doi: 10.1007/BF01186082 pmid: 24226357
[32]	Rahman MA, Thomson MJ, Shah-E-Alam M, et al. Exploring novel genetic sources of salinity tolerance in rice through molecular and physiological characterization[J]. Ann Bot, 2016, 117(6):1083-1097. doi: 10.1093/aob/mcw030 URL