Synthesis of Circular Full-length Human Mitochondrial DNA Based on Yeast Cloning and Staggered Thermal Cycling Ligation

doi:10.13560/j.cnki.biotech.bull.1985.2025-1470

Abstract

Abstract:

Objective Mutations in human mitochondrial DNA (mtDNA) are associated with various diseases. However, the full-length sequence is unstable in prokaryotic hosts, and the in vitro preparation of large circular DNA fragments also remains challenging. Therefore, there is an urgent need for a new strategy to efficiently produce circularized full-length mtDNA, in order to overcome the critical technical bottleneck in mitochondrial genetic manipulation. Method First, to effectively overcome the host toxicity issues inherent in traditional prokaryotic cloning systems, we successfully cloned the full-length human mitochondrial genome into a yeast vector by leveraging the highly efficient homologous recombination system of Saccharomyces cerevisiae. Concurrently, site-directed editing was performed to eliminate the endogenous Eco RI restriction sites, thereby providing genetic screening markers for the artificially synthesized mtDNA. Subsequently, to address the challenge of circularizing linear PCR products, we developed a novel in vitro thermal cycling ligation strategy based on staggered linearized fragments. This method utilizes a thermostable ligase to drive the formation of heteroduplexe cohesive ends during denaturation-renaturation cycles, thereby achieving efficient circularization of long DNA fragments. Result Experimental results demonstrated the successful synthesis of the 16.6 kb full-length human mitochondrial genome. Restriction mapping and exonuclease resistance assays confirmed that the synthesized product consists of sequence-correct, nick-free, covalently closed circular DNA. Conclusion The yeast-assisted editing and in vitro cyclic assembly technological system established in this study not only overcomes the difficulty of preparing high-quality circular full-length mtDNA, but also provides a versatile genetic manipulation platform for constructing mitochondrial disease models, synthesizing artificial mitochondria, and developing mitochondrial gene therapy vectors.

Key words: mitochondrial genome, homologous recombination, cross-annealing, thermal cycling ligation, DNA circularization, in vitro synthesis

PENG Wen-hui, LI Guan-chu, LIU Yong-min, MA Wen-jian, GUO Xiao-xian. Synthesis of Circular Full-length Human Mitochondrial DNA Based on Yeast Cloning and Staggered Thermal Cycling Ligation[J]. Biotechnology Bulletin, doi: 10.13560/j.cnki.biotech.bull.1985.2025-1470.

Figures/Tables 5

Table 1 Primers used in this study

引物名称 Primer	引物序列 Primer sequence （5′-3′）	说明 Notes
A_F1	tgagttacctcactcattagTATGTGTTGTCGTGCAGGTAGAGG	小写字符为pRS415同源序列（Lowercase letters indicate homologous sequences to the pRS415 vector）
D_R4	acaaggaagtacaggacaattgATGACCCACCAATCACATGCCTATCATATAGT
A_R1	GGCCATTATCGAAGAATTTACAAAAAACAATAGC	加粗字符为EcoRI位点内所引入的突变碱基（Bold characters represent the mutated bases introduced within the EcoRI recognition site）
B_F2	GCTATTGTTTTTTGTAAATTCTTCGATAATGGCC
B_R2	CCCTGTTCTTATGAATCCGAACAGCATAC
C_F3	GTATGCTGTTCGGATTCATAAGAACAGGG
C_R3	GGTCCATCATAGAATTTTCACTGTGATAT
D_F4	ATATCACAGTGAAAATTCTATGATGGACC
59F	/5Phos/GGCCCTCTCAGCCCTCCTAATGAC	/5Phos/为5′端磷酸化修饰（/5Phos/ indicates a 5' phosphorylation modification）
59R	/5Phos/CCTGTTAGGGGTCATGGGCTGGGTTTTACTATATGATAGGCATGTGATTGGTGGGTCATTATGTGTTGTCGTGCAGGTAGAGGC
F40	/5Phos/AAAACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAGCCATGTGAT
R41	/5Phos/ACTATATGATAGGCATGTGATTGGTGGGTCATTATGTGTTGTCGTGCAGGTAGAGGCTTACTAGAAGTGTG

Fig. 1 Construction and verification of recombinant clone of EcoRI-free full-length human mitochondrial genomeA: Gel electrophoresis of the four overlapping PCR fragments used for yeast homologous recombination. M: DNA marker. B: Validation of the assembled mtDNA. Lane 1: Full-length PCR product amplified by primers F40/R41. Lane 2: Restriction digest with ClaI and BamHI showing expected fragments (~8 kb, 5 kb, and 3.5 kb). C-E: Sequencing chromatograms confirming synonymous mutations (red boxes) that eliminate EcoRI sites. C: ND1 (m.4125T>C); D:ND2 (m.5280C>T); E: ND5 (m.12645C>T). Top: Wild-type sequence; bottom: mutated sequence

Fig. 2 Schematic illustration of the staggered linear DNA circularization strategyBlunt-ended fragments with staggered termini undergo denaturation-renaturation cycles. Cross-hybridization between complementary strands generates cohesive-ended heteroduplexes (middle panel) that serve as substrates for intramolecular ligation into circular DNA (bottom panel). Blunt-ended homoduplexes (top panel) are recycled through further thermal cycles, shifting the equilibrium toward circular product accumulation

Fig. 3 Detection and validation of pUC19 recircularization via misprimed linearization followed by denaturation-renaturation-ligation cyclingAgarose gel electrophoresis analysis of the reaction products. Lanes 1-3 (Controls): Native circular pUC19 exhibits resistance to Exonuclease V digestion (Lane 1), whereas the staggered linear substrate is completely degraded (Lane 3), confirming the selectivity of the exonuclease. Lane 4: Thermal cycling without Ampligase yields re-annealed complexes (likely nicked or concatenated). Lanes 5-6: The full ligation reaction generates products (Lane 5) that remain detectable after Exonuclease V treatment (Lane 6), confirming the formation of covalently closed circular DNA. Lane 7: Linearization of the Exonuclease V-resistant product with BamHI restores a single band identical in size to the input linear substrate (Lane 2), verifying the correct assembly of the monomeric plasmid

Fig. 4 In vitro circularization and validation of the full-length human mitochondrial genomeA: Electrophoretic analysis of the circularization products. Lane 1: Mixture of overlapping linear mtDNA fragments. Lanes 2 and 5: Products obtained after thermal cycling ligation at 60 ℃ and 70 ℃, respectively. Lanes 3 and 6: HindIII restriction digests of the circularization products. The appearance of a characteristic ~5.5 kb band (fusion of the 3003 bp and 2 474 bp terminal fragments) confirms successful circularization, distinct from the linear restriction pattern. Lanes 4 and 7: Products treated with Exonuclease V, showing resistant high-molecular-weight bands indicative of circular structure. M: DNA Marker. B: Validation of covalently closed circular (ccc) DNA using T5 Exonuclease. Lane 1: The cyclized product retains a resistant band, confirming the formation of nick-free cccDNA. Lane 2: Linear mtDNA control is completely degraded. M: DNA Marker. C: Sequence verification of the ligation junction. Top: Schematic illustrating the binding sites of the primer pairs (59F/R and F40/R41) at the boundary of the ATP6 and COX3 genes. Bottom: Sanger sequencing chromatogram of the T5 Exonuclease-resistant product, confirming the precise sequence restoration across the ligation site without mutations or deletions

References 17

[1]	Schon EA, DiMauro S, Hirano M. Human mitochondrial DNA: roles of inherited and somatic mutations [J]. Nat Rev Genet, 2012, 13(12): 878-890.
[2]	Park J, Baruch-Torres N, Yin YW. Structural and molecular basis for mitochondrial DNA replication and transcription in health and antiviral drug toxicity [J]. Molecules, 2023, 28(4): 1796.
[3]	Belousova V, Ignatko I, Bogomazova I, et al. Causes of and solutions to mitochondrial disorders: a literature review [J]. Int J Mol Sci, 2025, 26(14): 6645.
[4]	Mei JL, Ding P, Gao C, et al. Mitochondrial diseases: molecular pathogenesis and therapeutic advances [J]. MedComm, 2025, 6(9): e70385.
[5]	Tapper DP, Van Etten RA, Clayton DA. Isolation of mammalian mitochondrial DNA and RNA and cloning of the mitochondrial genome [M]//Biomembranes Part K: Membrane Biogenesis: Assembly and Targeting (Prokaryotes, Mitochondria, and Chloroplasts). Amsterdam: Elsevier 1983: 426-434.
[6]	Mita S, Monnat RJ, Loeb LA. Direct selection of mutations in the human mitochondrial tRNA^Thr gene: reversion of an ‘uncloneable’ phenotype [J]. Mutat Res Mutagen Relat Subj, 1988, 199(1): 183-190.
[7]	Ruiz E, Talenton V, Dubrana MP, et al. CReasPy-cloning: a method for simultaneous cloning and engineering of megabase-sized genomes in yeast using the CRISPR-Cas9 system [J]. ACS Synth Biol, 2019, 8(11): 2547-2557.
[8]	Bigger BW, Liao AY, Sergijenko A, et al. Trial and error: how the unclonable human mitochondrial genome was cloned in yeast [J]. Pharm Res, 2011, 28(11): 2863-2870.
[9]	Gammage PA, Rorbach J, Vincent AI, et al. Mitochondrially targeted ZFNs for selective degradation of pathogenic mitochondrial genomes bearing large-scale deletions or point mutations [J]. EMBO Mol Med, 2014, 6(4): 458-466.
[10]	Reddy P, Ocampo A, Suzuki K, et al. Selective elimination of mitochondrial mutations in the germline by genome editing [J]. Cell, 2015, 161(3): 459-469.
[11]	Lim K. Mitochondrial genome editing: strategies, challenges, and applications [J]. BMB Rep, 2024, 57(1): 19-29.
[12]	Guo JY, Chen XX, Liu ZW, et al. DdCBE mediates efficient and inheritable modifications in mouse mitochondrial genome [J]. Mol Ther Nucleic Acids, 2022, 27: 73-80.
[13]	Cho SI, Lim K, Hong S, et al. Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNA [J]. Cell, 2024, 187(1): 95-109, e26.
[14]	Yamada Y, Fukuda Y, Harashima H. An analysis of membrane fusion between mitochondrial double membranes and MITO-Porter, mitochondrial fusogenic vesicles [J]. Mitochondrion, 2015, 24: 50-55.
[15]	Rai PK, Craven L, Hoogewijs K, et al. Advances in methods for reducing mitochondrial DNA disease by replacing or manipulating the mitochondrial genome [J]. Essays Biochem, 2018, 62(3): 455-465.
[16]	Sercel AJ, Patananan AN, Man TX, et al. Stable transplantation of human mitochondrial DNA by high-throughput, pressurized isolated mitochondrial delivery [J]. eLife, 2021, 10: e63102.
[17]	Kukat A, Kukat C, Brocher J, et al. Generation of rho0 cells utilizing a mitochondrially targeted restriction endonuclease and comparative analyses [J]. Nucleic Acids Res, 2008, 36(7): e44.