A CRISPR-Cas12a-based Detection Method for Respiratory Syncytial Virus

doi:10.13560/j.cnki.biotech.bull.1985.2024-0433

Abstract

Abstract:

【Objective】Respiratory syncytial virus（RSV）is the most common cause of acute respiratory infections in infants. This study is aimed to establish a rapid and specific detection method for RSV based on the combination of RT-ETA and CRISPR-Cas12a.【Method】Specific crRNA and ERA primers were designed and synthesized for conserved fragments of the RSV N gene, and the optimal primer-crRNA sequence combination was selected to establish the detection system. The sensitivity and specificity of the method were evaluated by detecting the generated fluorescent signal.【Result】According to the activation principle of Cas12a, RSV-crRNA1 for RSV A and RSV-crRNA2 for RSV B were designed and synthesized, respectively. There was a synergistic interaction when RSV-crRNA1 and RSV-crRNA2 were mixed into the detection system. Meanwhile, RSVA and RSVB could be detected simultaneously by the mixed crRNA. With the highest fluorescence intensity, the forward prime combined with the reverse primer（RSV-F + RSV-R3J）was selected as the optimal primer pair. This method was able to detect RSV at titers as low as 5×10² copies/mL within 35 min under the constant temperature condition of 39℃. And no cross-reaction with other pathogens was observed. Only RSV nucleic acids were detected, indicating it was of high specificity.【Conclusion】Based on the a RT-ERA-CRISPR/Cas12a technology, a method of detecting RSV with high sensitivity, strong speficity, apid, and low cost for RSV detection is successfully established. This method does not demand complicated instrumentation, and it can be applied in any fluorescence laboratory equipment capable of providing a constant temperature. Thus this method is suitable for point-of-care test of RSV, and may also for detecting other pathogen infections.

Key words: respiratory syncytial virus, CRISPR-Cas12a technology, enzymatic recombinase amplification, point-of-care test, nucleic acid testing

YAO Xue-chun, LI Lei, WANG Zhi-xian, SHENG Chang-zhong, ZHOU Zeqi, TAN Cherie S. A CRISPR-Cas12a-based Detection Method for Respiratory Syncytial Virus[J]. Biotechnology Bulletin, 2025, 41(1): 103-109.

Figures/Tables 5

Table 1 Sequence information of ERA primers and crRNA

名称Name	序列 Sequence（5'-3'）
RSV-F	ATGGCTCTTAGCAAAGTCAAGTTGAATGATAC
RSV-R1	GTGAATTTATGATTAGCATCTTCTGTGATTAAT
RSV-R2	ATTTATGATTAGCATCTTCTGTGATTAATAACAT
RSV-R3	CTTCCTAATCTAGACATAGCATATAACATACCT
RSV-R4	GTGTCTTCTCTTCCTAATCTAGACATAGCATAT
RSV-R2J	ATTTATGATTAGCATCTTCTGTGATTAATARCAT
RSV-R3J	CTTCCTAATCTAGACATAGCATATARCATACCT
RSV-crRNA1	UAAUUUCUACUAAGUGUAGAUUGCACAUCAUAAUUAGGAGU
RSV-crRNA2	UAAUUUCUACUAAGUGUAGAUUGCACAUCAUAAUUGGGAGU
RSVA N基因	OP890340.1
RSVB N基因	MZ516051.1
ssDNA reporter	6-FAM-TTAATT-BHQ1

Fig. 1 Results of crRNA activity test A: Detected fluorescence results of CRISPR/Cas12a with crRNA1. B: Bar graph of detected end-point fluorescence value. *** P < 0.001. C, D: Co-detected results of crRNA1 and crRNA2. The same below

Fig. 2 Screeing of RT-ERA primer A, C: Deteced fluorescence curves of RT-ERA-CRISPR/Cas12a with different primers. B, D: Bar graph of end-point fluorescence value. **P < 0.01, *P < 0.05. The same below

Fig. 3 Sensitivity test results A: Fluorescence curves of the sensitivity test. B: Bar graph of end-point fluorescence value in sensitivity test

Fig. 4 Specificity test results A: Fluorescence curves of specificity test. B: Bar graph of end-point fluorescence value in specificity test. C: Curves of fluorescence intensity in the specificity test of mixed samples. D: Bar graph of the fluorescence intensity in the speciticity test of mixed samples

References 32

[1]	Nair H, Nokes DJ, Gessner BD, et al. Global burden of acute lower respiratory infections due to respiratory syncytial virus in young children: a systematic review and meta-analysis[J]. Lancet, 2010, 375(9725): 1545-1555. doi: 10.1016/S0140-6736(10)60206-1 pmid: 20399493
[2]	Li Y, Wang X, Blau DM, et al. Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in children younger than 5 years in 2019: a systematic analysis[J]. Lancet, 2022, 399(10340): 2047-2064. doi: 10.1016/S0140-6736(22)00478-0 pmid: 35598608
[3]	Li ZJ, Zhang HY, Ren LL, et al. Etiological and epidemiological features of acute respiratory infections in China[J]. Nat Commun, 2021, 12(1): 5026.
[4]	Ren LS, Lin L, Zhang H, et al. Epidemiological and clinical characteristics of respiratory syncytial virus and influenza infections in hospitalized children before and during the COVID-19 pandemic in Central China[J]. Influenza Other Respir Viruses, 2023, 17(2): e13103.
[5]	Di Mattia G, Nenna R, Mancino E, et al. During the COVID-19 pandemic where has respiratory syncytial virus gone?[J]. Pediatr Pulmonol, 2021, 56(10): 3106-3109.
[6]	Foley DA, Yeoh DK, Minney-Smith CA, et al. The interseasonal resurgence of respiratory syncytial virus in Australian children following the reduction of coronavirus disease 2019-related public health measures[J]. Clin Infect Dis, 2021, 73(9): e2829-e2830.
[7]	Larsson E, Johansson S, Frøbert O, et al. Evaluation of the ImmuView RSV test for rapid detection of respiratory syncytial virus in adult patients with influenza-like symptoms[J]. Microbiol Spectr, 2021, 9(3): e0093721.
[8]	Griffiths C, Drews SJ, Marchant DJ. Respiratory syncytial virus: infection, detection, and new options for prevention and treatment[J]. Clin Microbiol Rev, 2017, 30(1): 277-319. pmid: 27903593
[9]	Horvath P, Barrangou R. CRISPR/Cas, the immune system of bacteria and Archaea[J]. Science, 2010, 327(5962): 167-170. doi: 10.1126/science.1179555 pmid: 20056882
[10]	Chen JS, Ma EB, Harrington LB, et al. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity[J]. Science, 2018, 360(6387): 436-439. doi: 10.1126/science.aar6245 pmid: 29449511
[11]	Gootenberg JS, Abudayyeh OO, Kellner MJ, et al. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6[J]. Science, 2018, 360(6387): 439-444. doi: 10.1126/science.aaq0179 pmid: 29449508
[12]	Gootenberg JS, Abudayyeh OO, Lee JW, et al. Nucleic acid detection with CRISPR-Cas13a/C2c2[J]. Science, 2017, 356(6336): 438-442. doi: 10.1126/science.aam9321 pmid: 28408723
[13]	Li SY, Cheng QX, Wang JM, et al. CRISPR-Cas12a-assisted nucleic acid detection[J]. Cell Discov, 2018, 4: 20.
[14]	Gong L, Wang XW, Li Z, et al. Integrated trinity test with RPA-CRISPR/Cas12a-fluorescence for real-time detection of respiratory syncytial virus A or B[J]. Front Microbiol, 2022, 13: 819931.
[15]	Gao HD, Du Y, Chai Q, et al. A multiplex recombinase polymerase amplification assay combined with CRISPR/Cas12a for the detection of respiratory syncytial virus and respiratory adenovirus[J]. J Int Med Res, 2024, 52(1): 3000605231223083.
[16]	Zhou HF, Tsou JH, Chinthalapally M, et al. Detection and differentiation of SARS-CoV-2, influenza, and respiratory syncytial viruses by CRISPR[J]. Diagnostics, 2021, 11(5): 823.
[17]	Liu SH, Huang MQ, Xu YN, et al. CRISPR/Cas12a technology combined with RT-ERA for rapid and portable SARS-CoV-2 detection[J]. Virol Sin, 2021, 36(5): 1083-1087. doi: 10.1007/s12250-021-00406-7 pmid: 34076866
[18]	Yang KK, Liang YQ, Li YN, et al. Reverse transcription-enzymatic recombinase amplification coupled with CRISPR-Cas12a for rapid detection and differentiation of PEDV wild-type strains and attenuated vaccine strains[J]. Anal Bioanal Chem, 2021, 413(30): 7521-7529. doi: 10.1007/s00216-021-03716-7 pmid: 34686895
[19]	Yang KK, Zhang WY, Xu L, et al. Facile, ultrasensitive, and highly specific diagnosis of goose astrovirus via reverse transcription-enzymatic recombinase amplification coupled with a CRISPR-Cas12a system detection[J]. Poult Sci, 2022, 101(12): 102208.
[20]	Zhang WY, Xu L, Liu Q, et al. Enzymatic recombinase amplification coupled with CRISPR-Cas12a for ultrasensitive, rapid, and specific Porcine circovirus 3 detection[J]. Mol Cell Probes, 2021, 59: 101763.
[21]	Shinoda H, Iida T, Makino A, et al. Automated amplification-free digital RNA detection platform for rapid and sensitive SARS-CoV-2 diagnosis[J]. Commun Biol, 2022, 5(1): 473. doi: 10.1038/s42003-022-03433-6 pmid: 35614128
[22]	Haddadin Z, Beveridge S, Fernandez K, et al. Respiratory syncytial virus disease severity in young children[J]. Clin Infect Dis, 2021, 73(11): e4384-e4391.
[23]	Borchers AT, Chang C, Gershwin ME, et al. Respiratory syncytial virus—a comprehensive review[J]. Clin Rev Allergy Immunol, 2013, 45(3): 331-379.
[24]	Paul R, Ostermann E, Wei QS. Advances in point-of-care nucleic acid extraction technologies for rapid diagnosis of human and plant diseases[J]. Biosens Bioelectron, 2020, 169: 112592.
[25]	Nie K, Qi SX, Zhang Y, et al. Evaluation of a direct reverse transcription loop-mediated isothermal amplification method without RNA extraction for the detection of human enterovirus 71 subgenotype C4 in nasopharyngeal swab specimens[J]. PLoS One, 2012, 7(12): e52486.
[26]	Zhu HL, Zhang HQ, Xu Y, et al. PCR past, present and future[J]. BioTechniques, 2020, 69(4): 317-325.
[27]	Glökler J, Lim TS, Ida J, et al. Isothermal amplifications - a comprehensive review on current methods[J]. Crit Rev Biochem Mol Biol, 2021, 56(6): 543-586.
[28]	Lau HY, Botella JR. Advanced DNA-based point-of-care diagnostic methods for plant diseases detection[J]. Front Plant Sci, 2017, 8: 2016. doi: 10.3389/fpls.2017.02016 pmid: 29375588
[29]	Zyrina NV, Antipova VN. Nonspecific synthesis in the reactions of isothermal nucleic acid amplification[J]. Biochem Mosc, 2021, 86(7): 887-897.
[30]	Hu YH, Wan ZZ, Mu YL, et al. A quite sensitive fluorescent loop-mediated isothermal amplification for rapid detection of respiratory syncytial virus[J]. J Infect Dev Ctries, 2019, 13(12): 1135-1141.
[31]	Zasada AA, Zacharczuk K, Formińska K, et al. Isothermal DNA amplification combined with lateral flow dipsticks for detection of biothreat agents[J]. Anal Biochem, 2018, 560: 60-66. doi: S0003-2697(18)30708-5 pmid: 30217500
[32]	Li HJ, Yang J, Wu GF, et al. Amplification-free detection of SARS-CoV-2 and respiratory syncytial virus using CRISPR Cas13a and graphene field-effect transistors[J]. Angew Chem Int Ed Engl, 2022, 61(32): e202203826.