Expression and Purification of the MLL3SET Protein with a Site-directed Mutation of an Unnatural Amino Acid

doi:10.13560/j.cnki.biotech.bull.1985.2021-0465

Abstract

Abstract:

This work aims to introduce the unnatural amino acid,N-propargyl-lysine（PrK）,into the catalytic domain（MLL3_SET）of histone H3K4 methyltransferase MLL3,to express and purify the mutant protein（MLL3_SET*）,and evaluate its enzyme activity,which will lay the foundation for further single-molecule fluorescence resonance energy transfer（smFRET）experiments to characterize the mechanism of MLL3. MLL3_SET was linked into pET-28b（+）to construct an expression vector. Residue N4905 was selected for PrK introduction upon MLL3_SET crystal structure analysis. The commercial E.coli strain（C321. ΔA. exp）was genetically modified to integrate the T7 RNA polymerase gene. Further,MLL3_SET* was expressed and purified in the modified strain,and finally the enzyme activity was determined. The results showed that the constructed C321. ΔA. exp lacZ∷T7p07 strain harboring the pET28b-MLL3_SET* plasmid normally expressed the target protein after co-transformation with the aaRS-tRNA orthogonal system and the addition of PrK. The MLL3_SET* was purified successfully by Ni-NTA affinity chromatography and gel filtration chromatography. The results of the multi-component enzyme-coupled reaction showed that although the enzyme activity of MLL3_SET* was lower than that of wild-type MLL3_SET,it retained about 43% of the wild-type enzyme activity. This study successfully achieves prokaryotic expression and purification of PrK labeled MLL3_SET protein retaining certain enzymatic activity,which lays a foundation for the subsequent in-depth study of the molecular mechanism of MLL3_SET.

Key words: MLL3_SET, genome modification, unnatural amino acid, expression and purification, enzyme activity

WANG Xiao-qin, HUANG Yin-ping, WANG Wei-qian, WU Ping, QUAN Shu. Expression and Purification of the MLL3_SET Protein with a Site-directed Mutation of an Unnatural Amino Acid[J]. Biotechnology Bulletin, 2022, 38(3): 194-202.

Figures/Tables 10

Table 1 Primer sequences of PCR reactions

引物名称 Primer name	序列 Sequence（5'-3'）
Kan-F	TTCGCGTTCGCGTAAGTGTAGGCTGGAGCTGC
Kan-R	TTACGCGAAATACGGGCAGACATGGCCTGCC- CGGTTATTAATATCCTCCTTAGTTCCTATTCC
T7p07-F	GGAATTGTGAGCGGATAACAATTTCACACAGG- AAACAGCTATGAACACGATTAACATCGCTAAG
T7p07-R	CTCCAGCCTACACTTACGCGAACGCGAAGTCC
（T7p07+Kan）-F	GGAATTGTGAGCGGATAAC
（T7p07+Kan）-R	TTACGCGAAATACGGGCAG
F1	CCAGAAAGGAGAAGAGCTCTCCTATGACTAT- AAGTTTGAC
R1	GTCAAACTTA TAGTCATAG GAGAGCTCTTCT- CCTTTCTGG
F2	GAGAAGCTTTATGAGTGTCAGAACCGTGGTG- TGTAC
R2	GTACACACCACGGTTCTGACACTCATAAAGC- TTCTC
F3	GTGGAGCTGTGTAGTGCCGGAAGTGGATG
R3	CATCCACTTCCGGCACTACACAGCTCCAC

Fig. 1 Diagram of the multi-enzyme coupling reaction for determining MLL3SET* activity Under the catalysis of MLL3SET and AR compound（M3AR）and other enzymes,SAM undergoes multiple reactions. The final product N-（4-antipyryl）-3-chloro-5-sulfonate-ρ-benzoquinone-monoimine shows absorbance at 515 nm

Fig. 2 Expression test after genomic modification M：Protein marker. U：Lysate of uninduced whole cell. I：Lysate of induced whole cell

Fig. 3 MLL3SET structural information（A）and the map of the expression plasmid （B） The cysteine at position 4 883 of MLL3SET is mutated to serine,serine at position 4 819 to cysteine,and asparagine at position 4 905 to the amber codon. A：Structural information of 6 cysteine residues in MLL3SET（PDB：5F6K）. MLL3SET is colored in yellow;the substrate H3 is colored in aquamarine. The product,SAH,6 cysteines,and the two sites chosen for smFRET labeling are displayed as the stick model. The zinc ion is shown in the grey sphere. B：pET28b-His-sumo-mll3set C4883S S4819C N4905X plasmid map

Fig. 4 Expression test of the pET28b-His-sumo-mll3set C4883S plasmid M：Protein marker. U：Uninduced whole cell after lysis. I：Induced whole cell after lysis. S：Induced supernatant after lysis. P：Induced precipitation after lysis. 37℃：Expression at 37℃. 16℃：Expression at 16℃

Fig. 5 Analysis of expressed His-SUMO-MLL3SET* A：SDS-PAGE analysis. B：Western blot analysis. M：Protein marker;1-4：The host strain was E. coli C321.ΔA. exp lacZ∷T7. 1：Uninduced whole cell after lysis. 2：Induced whole cell after lysis. 3：Supernatant of induced cells after lysis. 4：Precipitation of induced cells after lysis. 5-6：The host strain was E. coli BL21（DE3）. 5：Uninduced whole cell after lysis. 6：Induced whole cell after lysis

Fig. 6 Analysis of purified His-SUMO-MLL3SET* M：Protein marker. 1：Induced whole cell. 2：Supernatant of the induced cells. 3：Precipitation of the induced cells. 4：Flow through before washing. 5：Flow through after washing with 50 mL buffer. 6：Flow through after washing with 1 L buffer. 7：Suspended Ni beads with buffer before imidazole elution. 8：Imidazole eluted sample. 9：Suspended Ni beads with buffer after imidazole elution

Fig. 7 Separation of His-SUMO-MLL3SET* by gel filtration chromatography

Fig. 8 MS/MS diagram of the IPCHCGAVNCR peptide

Fig. 9 Activity of His-SUMO-MLL3SET* measured by a multi-enzyme coupling reaction A：Comparison of the activity of M*AR and MAR. B：Standard curve of SAH concentration and A515

References 24

[1]	Shilatifard A. The COMPASS family of histone H3K4 methylases:mechanisms of regulation in development and disease pathogenesis[J]. Annu Rev Biochem, 2012, 81:65-95. doi: 10.1146/annurev-biochem-051710-134100 pmid: 22663077
[2]	Ayton PM, Cleary ML. Molecular mechanisms of leukemogenesis mediated by MLL fusion proteins[J]. Oncogene, 2001, 20(40):5695-5707. pmid: 11607819
[3]	黎彦璟, 陈勇. 组蛋白甲基转移酶MLL1的结构与功能研究进展[J]. 中国细胞生物学学报, 2014, 36(7):857-868.
	Li YJ, Chen Y. Progress in structural and functional studies of histone methyltransferase MLL1[J]. Chin J Cell Biol, 2014, 36(7):857-868.
[4]	Dehé PM, Dichtl B, Schaft D, et al. Protein interactions within the Set1 complex and their roles in the regulation of histone 3 lysine 4 methylation[J]. J Biol Chem, 2006, 281(46):35404-35412. doi: 10.1074/jbc.M603099200 URL
[5]	Avdic V, Zhang P, Lanouette S, et al. Structural and biochemical insights into MLL1 core complex assembly[J]. Structure, 2011, 19(1):101-108. doi: 10.1016/j.str.2010.09.022 URL
[6]	Zhang Y, Mittal A, Reid J, et al. Evolving catalytic properties of the MLL family SET domain[J]. Structure, 2015, 23(10):1921-1933. doi: S0969-2126(15)00324-X pmid: 26320581
[7]	Southall SM, Wong PS, Odho Z, et al. Structural basis for the requirement of additional factors for MLL1 SET domain activity and recognition of epigenetic marks[J]. Mol Cell, 2009, 33(2):181-191. doi: 10.1016/j.molcel.2008.12.029 pmid: 19187761
[8]	Li Y, Han J, Zhang Y, et al. Structural basis for activity regulation of MLL family methyltransferases[J]. Nature, 2016, 530(7591):447-452. doi: 10.1038/nature16952 URL
[9]	Sasmal DK, Pulido LE, Kasal S, et al. Single-molecule fluorescence resonance energy transfer in molecular biology[J]. Nanoscale, 2016, 8(48):19928-19944. doi: 10.1039/C6NR06794H URL
[10]	Roy R, Hohng S, Ha T. A practical guide to single-molecule FRET[J]. Nat Methods, 2008, 5(6):507-516.
[11]	Zhang J, Fu Y, Lakowicz JR. Enhanced förster resonance energy transfer(FRET)on single metal particle[J]. J Phys Chem C Nanomater Interfaces, 2007, 111(1):50-56. doi: 10.1021/jp062665e URL
[12]	Zhang J, Fu Y, Chowdhury MH, et al. Enhanced förster resonance energy transfer on single metal particle. 2. dependence on donor-acceptor separation distance, particle size, and distance from metal surface[J]. J Phys Chem C, 2007, 111(32):11784-11792. doi: 10.1021/jp067887r pmid: 19890406
[13]	Lee TC, Kang M, Kim CH, et al. Dual unnatural amino acid incorporation and click-chemistry labeling to enable single-molecule FRET studies of p97 folding[J]. Chembiochem, 2016, 17(11):981-984. doi: 10.1002/cbic.v17.11 URL
[14]	Lang K, Chin JW. Cellular incorporation of unnatural amino acids and bioorthogonal labeling of proteins[J]. Chem Rev, 2014, 114(9):4764-4806. doi: 10.1021/cr400355w URL
[15]	Ryu Y, Schultz PG. Efficient incorporation of unnatural amino acids into proteins in Escherichia coli[J]. Nat Methods, 2006, 3(4):263-265.
[16]	Young TS, Ahmad I, Yin JA, et al. An enhanced system for unnatural amino acid mutagenesis in E. coli[J]. J Mol Biol, 2010, 395(2):361-374. doi: 10.1016/j.jmb.2009.10.030 URL
[17]	Smolskaya S, Andreev Y. Site-specific incorporation of unnatural amino acids into Escherichia coli recombinant protein:methodology development and recent achievement[J]. Biomolecules, 2019, 9(7):255. doi: 10.3390/biom9070255 URL
[18]	Lin X, Yu ACS, Chan TF. Efforts and challenges in engineering the genetic code[J]. Life, 2017, 7(1):12. doi: 10.3390/life7010012 URL
[19]	Young DD, Schultz PG. Playing with the molecules of life[J]. ACS Chem Biol, 2018, 13(4):854-870. doi: 10.1021/acschembio.7b00974 URL
[20]	Dorgan KM, Wooderchak WL, Wynn DP, et al. An enzyme-coupled continuous spectrophotometric assay for S-adenosylmethionine-dependent methyltransferases[J]. Anal Biochem, 2006, 350(2):249-255. doi: 10.1016/j.ab.2006.01.004 URL
[21]	Liu ZP. Histone methylation in heart development and cardiovascular disease[J]. Cardiac and Vascular Biology, 2016, 1:125-146.
[22]	Bale TL, Baram TZ, Brown AS, et al. Early life programming and neurodevelopmental disorders[J]. Biol Psychiatry, 2010, 68(4):314-319. doi: 10.1016/j.biopsych.2010.05.028 URL
[23]	Millan MJ. An epigenetic framework for neurodevelopmental disorders:from pathogenesis to potential therapy[J]. Neuropharmacology, 2013, 68:2-82. doi: 10.1016/j.neuropharm.2012.11.015 pmid: 23246909
[24]	Vissers LELM, Gilissen C, Veltman JA. Genetic studies in intellectual disability and related disorders[J]. Nat Rev Genet, 2016, 17(1):9-18. doi: 10.1038/nrg3999 URL