Identification and Expression Analysis of ARF Gene Family in Setaria viridis

doi:10.13560/j.cnki.biotech.bull.1985.2024-0318

Abstract

Abstract:

【Objective】 The auxin response factor（ARF）plays an important role in plant growth and development through regulating the expression of auxin response genes. The SvARF gene family members were identified from the Setaria viridis genome, and the expression characteristics of related genes were analyzed, providing support for further research on the relationship between SvARF and the growth and development of S. viridis. 【Method】 The ARF transcription factors were identified from the S. viridis genome by bioinformatics. The phylogenetic evolution, chromosome location, and gene structure were also analyzed. Real-time quantitative polymerase chain reaction（RT-qPCR）were used to analyze the expression responses of SvARF gene to 2,4-D isooctyl esters. 【Result】 A total of 24 SvARF genes were identified. The members of SvARF gene family can be divided into 4 subfamilies. SvARF genes in the same subfamily shared similar expression pattern and genes in subfamily III expressed specifically in the tillers. After 2,4-D isooctyl ester treatment, the relative expressions of nine SvARF genes changed significantly. SvARF5, SvARF6, SvARF9, SvARF10, SvARF17 and SvARF18 were up-regulated, while SvARF14, SvARF22, and SvARF24 were down-regulated. 【Conclusion】 There are 24 members in the SvARF gene family. Auxin pesticide affects the expressions of SvARF genes, which may decrease the plant tiller number.

Key words: ARF transcription factor, Setaria viridis, phylogenetic evolution, structure characteristics, gene expression, tillering, 2,4-D isooctyl ester

WANG Qi-xin, ZHANG Ling-xin, ZHONG Ni-na, XIONG Wang-dan. Identification and Expression Analysis of ARF Gene Family in Setaria viridis[J]. Biotechnology Bulletin, 2024, 40(11): 227-235.

Figures/Tables 9

Table 1 Primer sequences for quantitative real time PCR

基因名称Gene name	正向引物 Forword primer（5'-3'）	反向引物 Reverse primer（5'-3'）
SvARF5	GCAGTTCCGTCACATCTACCG	CGAGGAGTCATCCCAGTCAA
SvARF6	ACCCGTGGGAGTCATTTGTG	GATAGGTAGCGTGGATCGTTTC
SvARF9	AATTGGCTCGTTCGATTACG	ACTTGCCCTTGGCTGCTGT
SvARF10	TATTTGGGTTTCCTCTTGGTAG	TTCTGAACATTCTGGGTAGCCT
SvARF14	CCCTTCTTGCTCAACATCACC	CTTCGGCAGTTCCTTAGTCG
SvARF17	TTCTCCAAAGCCTGAGCAAT	CAAATCTTGGAACCCCGAAG
SvARF18	TGATGGTGAACTAAGACTGGGTG	AGACTGGACGGTTGAGGCTC
SvARF22	CCTGACCTCTGGCACCCTGAT	TCCCAAGCACAAGCACCCAC
SvARF24	GGTTTCTCATCTCAAGGTCGTG	AGCCTCCGTGCTACTTTCAT
SvActin	CAGTGGACGCACAACAGGTAT	AGCAAGGTCAAGACGGAGAAT

Fig. 1 Chromosomes distribution of SvARF genes

Fig. 2 Phylogenetic analysis of ARF protein in S. viridis and rice（Oryza sativa）

Fig. 3 Collinearity analysis among the SvARF gene family in S. viridis

Fig. 4 Analysis of SvARF gene structure in S. viridis

Fig. 5 Prediction of the tertiary structures of ARF proteins in S. viridis

Fig. 6 Expression pattern of SvARF genes in different tissues of S. viridis

Fig. 7 Relative expression analysis of SvARF genes in the tillers of S. viridis after spraying 2,4-D isooctyl ester The expression of SvARF genes under control T0-1 was defined as 1, and the relative expression of SvARF gene under treatment was determined by the relative fold changes between treatment and control. T-1 and T-2 refer to the concentration of 2,4-D isooctyl ester at 1 050 and 4 200 g a.i./ha, respectively. ** indicates P<0.01. The same below

Fig. 8 Content of IAA in the tillers of S. viridis after spraying 2,4-D isooctyl ester T-0 refers to the concentration of 2,4-D isooctyl ester at 0 g a.i./ha

References 32

[1]	Wang JH, Hu D, Shi XN, et al. Different responses of invasive weed Alternanthera philoxeroides and Oryza sativa to plant growth regulators[J]. Life, 2022, 12(7): 1069.
[2]	Guo F, Huang YZ, Qi PP, et al. Functional analysis of auxin receptor OsTIR1/OsAFB family members in rice grain yield, tillering, plant height, root system, germination, and auxinic herbicide resistance[J]. New Phytol, 2021, 229(5): 2676-2692.
[3]	Ishikawa S, Maekawa M, Arite T, et al. Suppression of tiller bud activity in tillering dwarf mutants of rice[J]. Plant Cell Physiol, 2005, 46(1): 79-86.
[4]	Yu HY, Cui HL, Chen JC, et al. Regulation of 2, 4-D isooctyl ester on Triticum aestivum and Aegilops tauschii tillering and endogenous phytohormonal responses[J]. Front Plant Sci, 2021, 12: 642701.
[5]	Roosjen M, Paque S, Weijers D. Auxin Response Factors: output control in auxin biology[J]. J Exp Bot, 2018, 69(2): 179-188.
[6]	Dinesh DC, Kovermann M, Gopalswamy M, et al. Solution structure of the PsIAA4 oligomerization domain reveals interaction modes for transcription factors in early auxin response[J]. Proc Natl Acad Sci USA, 2015, 112(19): 6230-6235.
[7]	Li YH, Han S, Qi YH. Advances in structure and function of auxin response factor in plants[J]. J Integr Plant Biol, 2023, 65(3): 617-632.
[8]	Wilmoth JC, Wang SC, Tiwari SB, et al. NPH4/ARF7 and ARF19 promote leaf expansion and auxin-induced lateral root formation[J]. Plant J, 2005, 43(1): 118-130.
[9]	Yang J, Tian L, Sun MX, et al. AUXIN RESPONSE FACTOR17 is essential for pollen wall pattern formation in Arabidopsis[J]. Plant Physiol, 2013, 162(2): 720-731.
[10]	Ellis CM, Nagpal P, Young JC, et al. AUXIN RESPONSE FACTOR 1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana[J]. Development, 2005, 132(20): 4563-4574.
[11]	Sims K, Abedi-Samakush F, Szulc N, et al. OsARF11 promotes growth, meristem, seed, and vein formation during rice plant development[J]. Int J Mol Sci, 2021, 22(8): 4089.
[12]	Li PH, Brutnell TP. Setaria viridis and Setaria italica, model genetic systems for the Panicoid grasses[J]. J Exp Bot, 2011, 62(9): 3031-3037.
[13]	Keshavarzi M, Seifali M. Systematic study of weedy species of Setaria(L.) P. Beauv.(Poaceae)in Iran[J]. Pak J Biol Sci, 2007, 10(19): 3362-3367.
[14]	Xiong WD, Xu XQ, Zhang L, et al. Genome-wide analysis of the WRKY gene family in physic nut(Jatropha curcas L.)[J]. Gene, 2013, 524(2): 124-132.
[15]	Zhao S, Zhang ML, Ma TL, et al. Phosphorylation of ARF2 relieves its repression of transcription of the K⁺ transporter gene HAK5 in response to low potassium stress[J]. Plant Cell, 2016, 28(12): 3005-3019.
[16]	Chen Y, Liu B, Zhao YJ, et al. Whole-genome duplication and purifying selection contributes to the functional redundancy of auxin response factor(ARF)genes in foxtail millet(Setaria italica L.)[J]. Int J Genomics, 2021, 2021: 2590665.
[17]	Wang DK, Pei KM, Fu YP, et al. Genome-wide analysis of the auxin response factors(ARF)gene family in rice(Oryza sativa)[J]. Gene, 2007, 394(1/2): 13-24.
[18]	Song H, Guo ZL, Zhang XJ, et al. De novo genes in Arachis hypogaea cv. Tifrunner: systematic identification, molecular evolution, and potential contributions to cultivated peanut[J]. Plant J, 2022, 111(4): 1081-1095.
[19]	Liu R, Guo ZF, Lu SY. Genome-wide identification and expression analysis of the Aux/IAA and auxin response factor gene family in Medicago truncatula[J]. Int J Mol Sci, 2021, 22(19): 10494.
[20]	Chen FQ, Zhang JQ, Ha X, et al. Genome-wide identification and expression analysis of the auxin-response factor(ARF)gene family in Medicago sativa under abiotic stress[J]. BMC Genomics, 2023, 24(1): 498.
[21]	Jiao YN. Double the genome, double the fun: genome duplications in angiosperms[J]. Mol Plant, 2018, 11(3): 357-358.
[22]	Peng YK, Zhao K, Zheng RY, et al. A comprehensive analysis of auxin response factor gene family in Melastoma dodecandrum genome[J]. Int J Mol Sci, 2024, 25(2): 806.
[23]	Okushima Y, Overvoorde PJ, Arima K, et al. Functional genomic analysis of the AUXIN RESPONSE FACTOR gene family members in Arabidopsis thaliana: unique and overlapping functions of ARF7 and ARF19[J]. Plant Cell, 2005, 17(2): 444-463.
[24]	Wang HX, Ren J, Zhou SY, et al. Molecular regulation of oil gland development and biosynthesis of essential oils in Citrus spp[J]. Science, 2024, 383(6683): 659-666.
[25]	Mockaitis K, Estelle M. Auxin receptors and plant development: a new signaling paradigm[J]. Annu Rev Cell Dev Biol, 2008, 24: 55-80.
[26]	Korasick DA, Jez JM, Strader LC. Refining the nuclear auxin response pathway through structural biology[J]. Curr Opin Plant Biol, 2015, 27: 22-28.
[27]	Chandler JW. Auxin response factors[J]. Plant Cell Environ, 2016, 39(5): 1014-1028.
[28]	Grossmann K. Auxin herbicides: current status of mechanism and mode of action[J]. Pest Manag Sci, 2010, 66(2): 113-120.
[29]	Yan M, Yan Y, Wang P, et al. Genome-wide identification and expression analysis of auxin response factor(ARF)gene family in Panax ginseng indicates its possible roles in root development[J]. Plants, 2023, 12(23): 3943.
[30]	Li Y, Li JL, Chen ZH, et al. OsmiR167a-targeted auxin response factors modulate tiller angle via fine-tuning auxin distribution in rice[J]. Plant Biotechnol J, 2020, 18(10): 2015-2026.
[31]	Li JC, Jiang YM, Zhang J, et al. Key auxin response factor(ARF)genes constraining wheat tillering of mutant dmc[J]. Peer J, 2021, 9: e12221.
[32]	Su LY, Zhang T, Yang B, et al. Different evolutionary patterns of TIR1/AFBs and AUX/IAAs and their implications for the morphogenesis of land plants[J]. BMC Plant Biol, 2023, 23(1): 265.