Genome-wide Identification of WRKY Gene Family in Gossypium hirsutum and Expression Analysis of WRKY44 in Fiber Development

doi:10.13560/j.cnki.biotech.bull.1985.2025-0390

Abstract

Abstract:

Objective To investigate the characteristics of the WRKY gene family in upland cotton (Gossypium hirsutum L.) and elucidate the roles of WRKY transcription factors in fiber growth and development, thereby providing insights into their underlying molecular mechanisms. Method Genome-wide identification of the GhWRKY genefamily was performed, including analyses of chromosomal localization, physicochemical properties, subcellular localization, gene structure, and promoter cis-elements. Moreover, real-time quantitative PCR (qPCR) was employed to analyze the expression patterns of the GhWRKY gene family during fiber development, and a virus-induced gene silencing approach was to analyze the function of GhWRKY44. Result A total of 225 WRKY family members were identified in the G. hirsutum genome, and classified into three subfamilies. These genes were unevenly distributed across 26 chromosomes. The promoter cis-elements analysis showed that the promoters of GhWRKYs contained numerous regulatory elements related to plant hormones, growth and development, stress responses, and light response. Eight GhWRKYs (GhWRKY11/14/31/48/133/149/160/224) had preferential expressions at different stages of fiber development. Among them, the gene GhWRKY14 and GhWRKY133 shared similar temporal expression patterns and three-dimensional structures and were identified as orthologs (copies) of Arabidopsis thalianaWRKY44 in G. hirsutum. Accordingly, both were collectively designated as GhWRKY44. Silencing of GhWRKY44 significantly inhibited the growth and development of trichomes. Conclusion This study provides a wide analysis of the WRKY gene family in G. hirsutum and screens the key gene GhWRKY44 in fiber growth and development, thus laying the foundation for further exploring the function of WRKY44 genes in fiber growth and development.

Key words: Gossypium hirsutum, WRKY gene family, WRKY44, genome-wide identification, fiber development, expression analysis

XU Jia-yu, ZHAO Ge, TANG Ye, LIU Wen-wen, PENG Qing-zhong, WU Jia-he. Genome-wide Identification of WRKY Gene Family in Gossypium hirsutum and Expression Analysis of WRKY44 in Fiber Development[J]. Biotechnology Bulletin, 2025, 41(12): 124-138.

Figures/Tables 12

Table 1 Primer names and sequences

引物名称 Primer name	序列 Sequence （5′‒3′）
qGhhis3-F	GACACCAACCTTTGCGCGAT
qGhhis3-R	AGCGACTGATCCACACTTCTG
qGhWRKY11-F	CCGAGCTCTTGGACTCTCCTGT
qGhWRKY11-R	TGTTGCGCAGTTTGATTTGCGT
qGhWRKY14-F	AGGCAGAGCAGTCCGGAATAGG
qGhWRKY14-R	TGATACAAGCTTTGCCTGCGGT
qGhWRKY31-F	GCTCGATTACCCCACGCTTCAA
qGhWRKY31-R	GCCCAGTAGGCGCAGTGAATAA
qGhWRKY48-F	GTCTCCTCCTGTAGCAAGCCAG
qGhWRKY48-R	ACACAGGTGTCTTCACAACGGG
qGhWRKY133-F	GGTTGTCTGTGCTTCCGGCTTA
qGhWRKY133-R	GCTCCCTCCTTGCTTGCTTCTT
qGhWRKY149-F	CTTCTGCTGGGTGTCCTGTACG
qGhWRKY149-R	GAGCAATTGGTTGGCCATGTCG
qGhWRKY160-F	TGGTCAGAAGCAAGTGAAGAGTCC
qGhWRKY160-R	TCTCAATTACATGGCCCGTCTGA
qWRKY224-F	GATGGGTATCGATGGCGCAAGT
qWRKY224-R	TGCTTTCGGATCATGAGACGCC

Fig. 1 Chromosome mapping of GhWRKY gene familyW1 is abbreviated from GhWRKY1. The same below

Fig. 2 Phylogenetic tree of GhWRKY gene family members

Fig. 3 Multi-sequence alignment of GhWRKYs

Fig. 4 Conserved motifs and gene structure analysis of GhWRKY gene family membersA: Phylogenetic tree of the GhWRKY family protein in G. hirsutum. B: Conserved motif of GhWRKY proteins in G. hirsutum. C: Gene structure of the GhWRKY gene family in G. hirsutum

Fig. 5 GhWRKYs cis-acting elements

Fig. 6 Expression analysis of GhWRKYs during fiber developmentThe genes highlighted in red boxes are predominantly expressed during different developmental stages of fiber and ovule. DPA: Day post anthesis. The same below

Fig. 7 Relative expressions of key GhWRKYs during different stages of cotton fiber developmentStatistical analyses were performed using the Tukey test. Different lower letters indicate significant difference of the expression of GhWRKYs at different stages of cotton fiber development (P<0.05)

Fig. 8 Homology analysis of GhWRKY44A: Phylogenetic tree of GhWRKY14 (Gh_A04G096000.1), GhWRKY133 (Gh_D04G134100.1) and AtWRKY44 (AT2G37260). B: Amino acid sequence comparison analysis of GhWRKY14, GhWRKY133 and AtWRKY44. C: 3D structures of GhWRKY14, GhWRKY133 and AtWRKY44 proteins

Fig. 9 Subcellular localization

Fig. 10 Cultivating of TRV:GhWRKY44-silenced plantsA: Schematic diagram of VIGS silencing vector. B: Fourteen days after Agrobacterium infestation of cotton, TRV:GhPDS plants showed a distinct albino phenotype. C: RT-qPCR detection of GhWRKY44, silencing efficiency, n=35. GhHis3 was used as the internal reference gene, and the error line was the standard error of three biological replicates. Statistical analysis was performed using an independent variance t-test, * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001. The same below

Fig. 11 Phenotypic characterization of epidermal trichomes in GhWRKY44-silenced plantsA: Trichome morphology of GhWRKY44-silenced plants. B: Statistical analysis of trichome density of GhWRKY44-silenced plants, n=15

References 50

[1]	Qin Y, Sun ML, Li WW, et al. Single-cell RNA-seq reveals fate determination control of an individual fibre cell initiation in cotton (Gossypium hirsutum) [J]. Plant Biotechnol J, 2022, 20(12): 2372-2388.
[2]	Tian HD, Wang QL, Yan XY, et al. The disruptions of sphingolipid and sterol metabolism in the short fiber of Ligon-lintless-1 mutant revealed obesity impeded cotton fiber elongation and secondary cell wall deposition [J]. Int J Mol Sci, 2025, 26(3): 1375.
[3]	Kim HJ, Triplett BA. Cotton fiber growth in planta and in vitro. Models for plant cell elongation and cell wall biogenesis [J]. Plant Physiol, 2001, 127(4): 1361-1366.
[4]	Haigler CH, Betancur L, Stiff MR, et al. Cotton fiber: a powerful single-cell model for cell wall and cellulose research [J]. Front Plant Sci, 2012, 3: 104.
[5]	Wu N, Yang J, Wang GN, et al. Novel insights into water-deficit-responsive mRNAs and lncRNAs during fiber development in Gossypium hirsutum [J]. BMC Plant Biol, 2022, 22(1): 6.
[6]	Sun XW, Qin AZ, Wang XX, et al. Spatiotemporal transcriptome and metabolome landscapes of cotton fiber during initiation and early development [J]. Nat Commun, 2025, 16(1): 858.
[7]	Wani SH, Anand S, Singh B, et al. WRKY transcription factors and plant defense responses: latest discoveries and future prospects [J]. Plant Cell Rep, 2021, 40(7): 1071-1085.
[8]	Song H, Cao YP, Zhao LG, et al. Review: WRKY transcription factors: Understanding the functional divergence [J]. Plant Sci, 2023, 334: 111770.
[9]	Eulgem T, Rushton PJ, Robatzek S, et al. The WRKY superfamily of plant transcription factors [J]. Trends Plant Sci, 2000, 5(5): 199-206.
[10]	Ishiguro S, Nakamura K. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1 that recognizes SP8 sequences in the 5' upstream regions of genes coding for sporamin and beta-amylase from sweet potato [J]. Mol Gen Genet, 1994, 244(6): 563-571.
[11]	Ülker B, Somssich IE. WRKY transcription factors: from DNA binding towards biological function [J]. Curr Opin Plant Biol, 2004, 7(5): 491-498.
[12]	Sahebi M, Hanafi MM, Rafii MY, et al. Improvement of drought tolerance in rice (Oryza sativa L.): genetics, genomic tools, and the WRKY gene family [J]. Biomed Res Int, 2018, 2018: 3158474.
[13]	Hu WJ, Ren QY, Chen YL, et al. Genome-wide identification and analysis of WRKY gene family in maize provide insights into regulatory network in response to abiotic stresses [J]. BMC Plant Biol, 2021, 21(1): 427.
[14]	Xing LN, Zhang YF, Ge MR, et al. Identification of WRKY gene family in Dioscorea opposita Thunb. reveals that DoWRKY71 enhanced the tolerance to cold and ABA stress [J]. Peer J, 2024, 12: e17016.
[15]	Lei L, Dong K, Liu SW, et al. Genome-wide identification of the WRKY gene family in blueberry (Vaccinium spp.) and expression analysis under abiotic stress [J]. Front Plant Sci, 2024, 15: 1447749.
[16]	Xiong R, Peng Z, Zhou H, et al. Correction: Genome-wide identification, structural characterization and gene expression analysis of the WRKY transcription factor family in pea (Pisum sativum L.) [J]. BMC Plant Biol, 2024, 24(1): 141.
[17]	Zhao H, Wang S, Chen S, et al. Phylogenetic and stress-responsive expression analysis of 20 WRKY genes in Populus simonii × Populus nigra [J]. Gene, 2015, 565(1): 130-139.
[18]	Johnson CS, Kolevski B, Smyth DR. TRANSPARENT TESTA GLABRA2 a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor [J]. Plant Cell, 2002, 14(6): 1359-1375.
[19]	Liu R, Xu YH, Jiang SC, et al. Light-harvesting chlorophyll a/b-binding proteins, positively involved in abscisic acid signalling, require a transcription repressor, WRKY40, to balance their function [J]. J Exp Bot, 2013, 64(18): 5443-5456.
[20]	Ding ZJ, Yan JY, Li GX, et al. WRKY41 controls Arabidopsis seed dormancy via direct regulation of ABI3 transcript levels not downstream of ABA [J]. Plant J, 2014, 79(5): 810-823.
[21]	Lei RH, Ma ZB, Yu DQ. WRKY2/34-VQ20 modules in Arabidopsis thaliana negatively regulate expression of a trio of related MYB transcription factors during pollen development [J]. Front Plant Sci, 2018, 9: 331.
[22]	Li W, Wang HP, Yu DQ. Arabidopsis WRKY transcription factors WRKY12 and WRKY13 oppositely regulate flowering under short-day conditions [J]. Mol Plant, 2016, 9(11): 1492-1503.
[23]	Ma ZB, Li W, Wang HP, et al. WRKY transcription factors WRKY12 and WRKY13 interact with SPL10 to modulate age-mediated flowering [J]. J Integr Plant Biol, 2020, 62(11): 1659-1673.
[24]	Zhang LP, Chen LG, Yu DQ. Transcription factor WRKY75 interacts with DELLA proteins to affect flowering [J]. Plant Physiol, 2018, 176(1): 790-803.
[25]	Rishmawi L, Pesch M, Juengst C, et al. Non-cell-autonomous regulation of root hair patterning genes by WRKY75 in Arabidopsis [J]. Plant Physiol, 2014, 165(1): 186-195.
[26]	Robatzek S, Somssich IE. Targets of AtWRKY6 regulation during plant senescence and pathogen defense [J]. Genes Dev, 2002, 16(9): 1139-1149.
[27]	Doll J, Muth M, Riester L, et al. Arabidopsis thaliana WRKY25 transcription factor mediates oxidative stress tolerance and regulates senescence in a redox-dependent manner [J]. Front Plant Sci, 2020, 10: 1734.
[28]	Chen LG, Xiang SY, Chen YL, et al. Arabidopsis WRKY45 interacts with the DELLA protein RGL1 to positively regulate age-triggered leaf senescence [J]. Mol Plant, 2017, 10(9): 1174-1189.
[29]	Jiang YJ, Yu DQ. The WRKY57 transcription factor affects the expression of jasmonate ZIM-domain genes transcriptionally to compromise Botrytis cinerea resistance [J]. Plant Physiol, 2016, 171(4): 2771-2782.
[30]	Wu XL, Shiroto Y, Kishitani S, et al. Enhanced heat and drought tolerance in transgenic rice seedlings overexpressing OsWRKY11 under the control of HSP101 promoter [J]. Plant Cell Rep, 2009, 28(1): 21-30.
[31]	He GH, Xu JY, Wang YX, et al. Drought-responsive WRKY transcription factor genes TaWRKY1 and TaWRKY33 from wheat confer drought and/or heat resistance in Arabidopsis [J]. BMC Plant Biol, 2016, 16(1): 116.
[32]	Li FJ, Li MY, Wang P, et al. Regulation of cotton (Gossypium hirsutum) drought responses by mitogen-activated protein (MAP) kinase cascade-mediated phosphorylation of GhWRKY59 [J]. New Phytol, 2017, 215(4): 1462-1475.
[33]	Li SJ, Fu QT, Chen LG, et al. Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance [J]. Planta, 2011, 233(6): 1237-1252.
[34]	Zhang Y, Yu HJ, Yang XY, et al. CsWRKY46, a WRKY transcription factor from cucumber, confers cold resistance in transgenic-plant by regulating a set of cold-stress responsive genes in an ABA-dependent manner [J]. Plant Physiol Biochem, 2016, 108: 478-487.
[35]	Yokotani N, Sato Y, Tanabe S, et al. WRKY76 is a rice transcriptional repressor playing opposite roles in blast disease resistance and cold stress tolerance [J]. J Exp Bot, 2013, 64(16): 5085-5097.
[36]	Wang NN, Li Y, Chen YH, et al. Phosphorylation of WRKY16 by MPK3-1 is essential for its transcriptional activity during fiber initiation and elongation in cotton (Gossypium hirsutum) [J]. Plant Cell, 2021, 33(8): 2736-2752.
[37]	Yang L, Qin WQ, Wei X, et al. Regulatory networks of coresident subgenomes during rapid fiber cell elongation in upland cotton [J]. Plant Commun, 2024, 5(12): 101130.
[38]	Yang DJ, Liu YY, Cheng HL, et al. Identification of the group ⅢWRKY subfamily and the functional analysis of GhWRKY53 in Gossypium hirsutum L [J]. Plants, 2021, 10(6): 1235.
[39]	Wang HP, Chen WQ, Xu ZY, et al. Functions of WRKYs in plant growth and development [J]. Trends Plant Sci, 2023, 28(6): 630-645.
[40]	Sun PW, Xu YH, Yu CC, et al. WRKY44 represses expression of the wound-induced sesquiterpene biosynthetic gene ASS1 in Aquilaria sinensis [J]. J Exp Bot, 2020, 71(3): 1128-1138.
[41]	Peng YY, Thrimawithana AH, Cooney JM, et al. The proanthocyanin-related transcription factors MYBC1 and WRKY44 regulate branch points in the kiwifruit anthocyanin pathway [J]. Sci Rep, 2020, 10(1): 14161.
[42]	Han Y, Zhang X, Wang W, et al. Correction: the suppression of WRKY44 by GIGANTEA-miR172 pathway is involved in drought response of Arabidopsis thaliana [J]. PLoS One, 2015, 10(4): e0124854.
[43]	Li QY, Yin M, Li YP, et al. Expression of Brassica napus TTG2 a regulator of trichome development, increases plant sensitivity to salt stress by suppressing the expression of auxin biosynthesis genes [J]. J Exp Bot, 2015, 66(19): 5821-5836.
[44]	Wen TY, Xu X, Ren AP, et al. Genome-wide identification of terpenoid synthase family genes in Gossypium hirsutum and functional dissection of its subfamily cadinene synthase A in gossypol synthesis [J]. Front Plant Sci, 2023, 14: 1162237.
[45]	Bencke-Malato M, Cabreira C, Wiebke-Strohm B, et al. Genome-wide annotation of the soybean WRKY family and functional characterization of genes involved in response to Phakopsora pachyrhizi infection [J]. BMC Plant Biol, 2014, 14: 236.
[46]	Shi GF, Liu GL, Liu HJ, et al. WRKY transcriptional factor IlWRKY70 from Iris laevigata enhances drought and salinity tolerances in Nicotiana tabacum [J]. Int J Mol Sci, 2023, 24(22): 16174.
[47]	Zhang JW, Huang DZ, Zhao XJ, et al. Drought-responsive WRKY transcription factor genes IgWRKY50 and IgWRKY32 from Iris germanica enhance drought resistance in transgenic Arabidopsis [J]. Front Plant Sci, 2022, 13: 983600.
[48]	Chen JN, Nolan TM, Ye HX, et al. Arabidopsis WRKY46, WRKY54, and WRKY70 transcription factors are involved in brassinosteroid-regulated plant growth and drought responses [J]. Plant Cell, 2017, 29(6): 1425-1439.
[49]	Shim JS, Jung C, Lee S, et al. AtMYB44 regulates WRKY70 expression and modulates antagonistic interaction between salicylic acid and jasmonic acid signaling [J]. Plant J, 2013, 73(3): 483-495.
[50]	Turck F, Zhou AF, Somssich IE. Stimulus-dependent, promoter-specific binding of transcription factor WRKY1 to its native promoter and the defense-related gene PcPR1-1 in Parsley [J]. Plant Cell, 2004, 16(10): 2573-2585.