Construction and Identification of Huh7 Hepatoma Cell Line with ACE2 Gene Knockout Based on CRISPR/Cas9 Technology

doi:10.13560/j.cnki.biotech.bull.1985.2022-1251

Abstract

Abstract:

The experiment is aimed to establish ACE2（angiotensin converting enzyme 2）-knock out Huh7 liver cancer cells using CRISPR-Cas9, which could be used as cell model to study the role of ACE2 in HCC（hepatocellular carcinoma）. Firstly, the ACE2 domain was identified, and two sgRNAs targeting ACE2 exons were designed using an online website that destroyed all the domains. Secondly, the recombinant vector was constructed and transfected into HCC cell Huh7, and the monoclonal cell line was screened by puromycin. Finally, the knockout effect was identified by immunoblotting. The domain identification results showed that there were Zn-binding sites and activation sites at amino acids 340-520. According to the sgRNA target design principle, two pairs of sgRNA were designed for the ninth and tenth exons of ACE2 by fragment knockout method, and the recombinant plasmid PX459-ACE2-sgRNA was successfully constructed. The monoclonal cell line was successfully screened by puromycin, sequencing confirmed the occurrence of fragment knockout, and ACE2 protein was not expressed in the ACE2 knockout cell line. CRISPR-Cas9 technology was used to successfully construct ACE2 knockout Huh7 cell line, which lays a foundation for future research on the mechanism of ACE2 in HCC.

Key words: angiotensin converting enzyme 2, hepatocellular carcinoma（HCC）, CRISPR-Cas9

ZHANG Zu-lin, LIU Fang-fang, ZHOU Qing-niao, ZHAO Rui-qiang, HE Shu-jia, LIN Wen-zhen. Construction and Identification of Huh7 Hepatoma Cell Line with ACE2 Gene Knockout Based on CRISPR/Cas9 Technology[J]. Biotechnology Bulletin, 2023, 39(6): 181-188.

Figures/Tables 9

Table 1 Sequencing primers and PCR sequences

名称Primer name	引物序列Primer sequence（5'-3'）
U6-F	ATGGACTATCATATGCTTACCGTA
CMV-R	TCGTTGGGCGGTCAGC
验证-F Verification-F	GACGACTTCCTGACAGCTCATCAT
验证-R Verification-R	AGTGTCACCTGACCCAAGGAAAT

Fig. 1 Identified ACE2 domain A: ACE2 domain identified by NCBI CD-search, with major domains marked in red boxes. B: The Esembl database searches for the protein domain encoded by the largest transcript of ACE2. Exons 9 and 10 and their domain are marked in red boxes

Table 2 Sequences of two sgRNAs targeting ACE2 gene

sgRNA	序列Sequence（5'-3'）
sgRNA1F	CACCGATCGGGTGACAGAAGACCAA
sgRNA1R	AAACTTGGTCTTCTGTCACCCGATC
sgRNA2F	CACCGTCGTGAGTGCTTGTTTGAGC
sgRNA2R	AAACGCTCAAACAAGCACTCACGAC

Fig. 2 Specificity score and off-target analysis of two sgRNA oligonucleotide fragments A: sgRNA1 specific score and off-target analysis; B: sgRNA2 specific score and off-target analysis

Fig. 3 Colony validation of PX459-sgRNA recombinant vector M: DL500 DNA marker. Lane 1 to 8 are PX459-ACE2-sgRNA1. Lane 9 to 16 are PX459-ACE2-sgRNA2

Fig. 4 Results of bidirectional sequencing of recombinant plasmid liquid A: PX459-ACE2-sgRNA1 sequencing peaks. B: PX459-ACE2-sgRNA2 sequencing peaks

Fig. 5 Agarose gel electrophoresis to verify the effect of gene editing M: DL10000 marker. Lane 1-5 are Huh7 wild-type; PXNC（control group）; PX1 #， PX2 #， PX3#（knockout group）

Fig. 6 Results of gene editing A: PXNC（control group）gene fragment. B: PX2#（knockout group）, gene fragment deletion after sgRNA acts on specific exons, which is connected to form repaired DNA fragment by non-homologous recombination. C: Blast comparison of PX2# monoclonal cell line and PXNC sequencing results showed that some exons and introns were missing, and the edited PX2# gene sequence was shown in red. Compared with PXNC, the PX2# gene with fragment knockout was fragmented

Fig. 7 Protein expression level verified by Western Blot

References 21

[1]	Zhang RK, Liu JL. Screening the genome for HCC-specific CpG methylation signatures as biomarkers for diagnosis and prognosis evaluation[J]. BMC Med Genomics, 2021, 14(1): 163. doi: 10.1186/s12920-021-01015-9
[2]	Chao JS, Zhao SL, Sun HC. Dedifferentiation of hepatocellular carcinoma: molecular mechanisms and therapeutic implications[J]. Am J Transl Res, 2020, 12(5): 2099-2109. pmid: 32509204
[3]	Moon H, Ro SW. MAPK/ERK signaling pathway in hepatocellular carcinoma[J]. Cancers, 2021, 13(12): 3026. doi: 10.3390/cancers13123026 URL
[4]	Xu JJ, Fan JS, Wu F, et al. The ACE2/angiotensin-(1-7)/mas receptor axis: pleiotropic roles in cancer[J]. Front Physiol, 2017, 8: 276. doi: 10.3389/fphys.2017.00276 pmid: 28533754
[5]	de Paula Gonzaga ALAC, Palmeira VA, Ribeiro TFS, et al. ACE2/angiotensin-(1-7)/mas receptor axis in human cancer: potential role for pediatric tumors[J]. Curr Drug Targets, 2020, 21(9): 892-901. doi: 10.2174/1389450121666200210124217 pmid: 32039680
[6]	Ender SA, Dallmer A, Lässig F, et al. Expression and function of the ACE2/angiotensin(1-7)/Mas axis in osteosarcoma cell lines U-2 OS and MNNG-HOS[J]. Mol Med Rep, 2014, 10(2): 804-810. doi: 10.3892/mmr.2014.2266 pmid: 24858078
[7]	Zhang Q, Lu SH, Li TF, et al. ACE2 inhibits breast cancer angiogenesis via suppressing the VEGFa/VEGFR2/ERK pathway[J]. J Exp Clin Cancer Res, 2019, 38(1): 173. doi: 10.1186/s13046-019-1156-5
[8]	Zhang ZL, Li L, Li MY, et al. The SARS-CoV-2 host cell receptor ACE2 correlates positively with immunotherapy response and is a potential protective factor for cancer progression[J]. Comput Struct Biotechnol J, 2020, 18: 2438-2444. doi: 10.1016/j.csbj.2020.08.024 URL
[9]	Li MY, Li L, Zhang Y, et al. Expression of the SARS-CoV-2 cell receptor gene ACE2 in a wide variety of human tissues[J]. Infect Dis Poverty, 2020, 9(1): 45. doi: 10.1186/s40249-020-00662-x
[10]	Ye GX, Qin Y, Lu XH, et al. The association of renin-angiotensin system genes with the progression of hepatocellular carcinoma[J]. Biochem Biophys Res Commun, 2015, 459(1): 18-23. doi: 10.1016/j.bbrc.2015.02.030 URL
[11]	Huang ML, Li X, Meng Y, et al. Upregulation of angiotensin-converting enzyme(ACE)2 in hepatic fibrosis by ACE inhibitors[J]. Clin Exp Pharmacol Physiol, 2010, 37(1): e1-e6. doi: 10.1111/cep.2009.37.issue-1 URL
[12]	Salmenkari H, Korpela R, Vapaatalo H. Renin-angiotensin system in intestinal inflammation-Angiotensin inhibitors to treat inflammatory bowel diseases?[J]. Basic Clin Pharmacol Toxicol, 2021, 129(3): 161-172. doi: 10.1111/bcpt.v129.3 URL
[13]	Amano H, Ito Y, Ogawa F, et al. Angiotensin II type 1A receptor signaling facilitates tumor metastasis formation through P-selectin-mediated interaction of tumor cells with platelets and endothelial cells[J]. Am J Pathol, 2013, 182(2): 553-564. doi: 10.1016/j.ajpath.2012.10.026 pmid: 23219751
[14]	Xu ZW, Yan SX, Wu HX, et al. The influence of TNF-α and Ang II on the proliferation, migration and invasion of HepG2 cells by regulating the expression of GRK2[J]. Cancer Chemother Pharmacol, 2017, 79(4): 747-758. doi: 10.1007/s00280-017-3267-z URL
[15]	Huang MM, Guo AB, Sun JF, et al. Angiotensin II promotes the progression of human gastric cancer[J]. Mol Med Rep, 2014, 9(3): 1056-1060. doi: 10.3892/mmr.2014.1891 URL
[16]	Wen SW, Ager EI, Neo J, et al. The renin angiotensin system regulates Kupffer cells in colorectal liver metastases[J]. Cancer Biol Ther, 2013, 14(8): 720-727. doi: 10.4161/cbt.25092 pmid: 23792575
[17]	Yu CH, Tang W, Wang YH, et al. Downregulation of ACE2/Ang-(1-7)/Mas axis promotes breast cancer metastasis by enhancing store-operated calcium entry[J]. Cancer Lett, 2016, 376(2): 268-277. doi: 10.1016/j.canlet.2016.04.006 pmid: 27063099
[18]	Zhou L, et al. Angiotensin-converting enzyme 2 acts as a potential molecular target for pancreatic cancer therapy[J]. Cancer Lett, 2011, 307(1): 18-25. doi: S0304-3835(11)00161-3 pmid: 21481527
[19]	Zong HJ, Yin BB, Zhou HD, et al. Loss of angiotensin-converting enzyme 2 promotes growth of gallbladder cancer[J]. Tumour Biol, 2015, 36(7): 5171-5177. doi: 10.1007/s13277-015-3171-2 URL
[20]	Gupta D, Bhattacharjee O, Mandal D, et al. CRISPR-Cas9 system: a new-fangled dawn in gene editing[J]. Life Sci, 2019, 232: 116636. doi: 10.1016/j.lfs.2019.116636 URL
[21]	Cong L, Zhang F. Genome engineering using CRISPR-Cas9 system[J]. Methods Mol Biol, 2015, 1239(11): 197-217.