Genome-wide Identification of HD-Zip Gene Family in Gossypium hirsutum L. and Expression Analysis in Response to Abiotic Stress

doi:10.13560/j.cnki.biotech.bull.1985.2023-0869

Abstract

Abstract:

【Objective】 HD-Zip（Homeodomain and Leucine zipper）family is one of the plant-specific transcription factor families, which plays an important role in plant growth and development and stress response. In this study, the members of GhHDZ gene family were identified from the whole genome of Gossypium hirsutum L. and the expression characteristics of related genes were analyzed to provide support for further research. 【Method】 The members of GhHDZ gene family were identified from TM-1 genome of G. hirsutum L. by bioinformatics, and their physicochemical properties, phylogenetic relationship, chromosome location, gene replication, gene structure and cis-acting elements in promoter region were analyzed. Transcriptome data and real-time quantitative polymerase chain reaction（RT-qPCR）were used to analyze the expression patterns of GhHDZ family genes under different abiotic stresses. The subcellular localization of the target protein was detected by tobacco transient transformation method, and the function of the target gene was verified by transgenic overexpression method. 【Result】 A total of 205 GhHDZ genes were identified in upland cotton genome, and the GhHDZ family was divided into 4 subgroups by phylogenetic analysis. Fragment replication was the main reason for the evolution of the GhHDZ gene family, and the gene family has undergone a strong purification selection. GhHDZ family members had potential diversity of biological functions. The analysis of abiotic stress transcriptome combined with RT-qPCR analysis of 10 GhHDZ genes showed that GhHDZ12, GhHDZ46 and GhHDZ119 positively responded to cold stress, GhHDZ15 and GhHDZ188 negatively responded to cold stress, GhHDZ15, GhHDZ46, GhHDZ50, GhHDZ76, GhHDZ116, GhHDZ146, GhHDZ176, GhHDZ188 positively responded to heat stress, and GhHDZ15, GhHDZ50, GhHDZ76, GhHDZ116, GhHDZ119, GhHDZ146, GhHDZ176, GhHDZ188 positively responded to salt stress. GhHDZ12, GhHDZ15, GhHDZ50, GhHDZ116, GhHDZ119, GhHDZ176, GhHDZ188 positively responded to drought stress, while GhHDZ76 negatively responded to drought stress, and it was found that the response times of these genes to various stresses were different. Further study on the function of GhHDZ146 showed that the gene was localized in the nucleus and heterologous overexpression in Arabidopsis, which significantly enhanced the tolerance to salt stress. 【Conclusion】 205 members of GhHDZ gene family are systematically identified from G. hirsutum L. within the whole genome. Different genes have different responses to various stresses, and there are differences in expression patterns. The positive response function of GhHDZ146 to salt stress is confirmed.

Key words: Gossypium hirsutum L., GhHDZ gene family, phylogeny, abiotic stress, expression pattern

WU Cui-cui, XIAO Shui-ping. Genome-wide Identification of HD-Zip Gene Family in Gossypium hirsutum L. and Expression Analysis in Response to Abiotic Stress[J]. Biotechnology Bulletin, 2024, 40(2): 130-145.

Figures/Tables 11

Table 1 Primers used in the study

基因名称Gene name	正向引物Forward primer（5'-3'）	反向引物Reverse primer（5'-3'）
GhHis3	F:CGGTGGTGTGAAGAAGCCTCAT	R:AATTTCACGAACAAGCCTCTGGAA
GhHDZ12	F:CAGGCAAAGCAAAGTGGAGA	R:AGATCTGCAGCTGGTTCACT
GhHDZ15	CGGGTGGGCACAAAATAAGT	TTGGTTTCAGAAATGGGGCC
GhHDZ46	F:CCACCACAAAAGCCTGTTGA	R:GGTCGGAGTAATCATTGCCT
GhHDZ50	F:CCAGCAAGTTTTTAGGGCGA	R:GGAACCACCGGCAAAGAATT
GhHDZ76	F:ATGCTGAGCTCCAAGTCCTT	R:ATCTTGCACAACACAGCCAG
GhHDZ116	F:GGCCCCATTTCTGAAACCAA	R:TGGCGACTCAACTTCTGTCT
GhHDZ119	F:ACCAGCTGCAGATCTCAACT	R:CCCTTGTTGGTGTTGGTGTT
GhHDZ146	F:CCACCACAAAAGCCTGTTGA	R:CGGGTCGGAGTAATCATTGT
GhHDZ176	F:ATGCTGAGCTCCAAGTCCTT	R:ATCTTGCACAACACAGCCAG
GhHDZ188	F:ACGTCGCACTTTTACCTTCG	R:ACCGTTTCAACCGATTCGAC
GhHDZ146-sub	F:TTGATACATATGCCCGTCGACATG	R:GTCGTGGTCCTTATAGTCGGATCCAT
GhHDZ146-sub	GCGGGTGGGAGGGTCTTCTCTTGTAA	AAGCCGAAGACCAGAAAGCATGATCTTC

Fig. 1 Phylogenetic analysis of HDZ proteins from G. hirsutum L. Different colors represent HD-ZipI, II, III and IV, respectively

Fig. 2 Chromosomal locations of GhHDZ gene family

Fig. 3 Syntenic relationship of GhHDZ gene family A01-A13 represent the A subgroup chromosomes of upland cotton, and D01-D13 represent the D subgroup chromosomes of upland cotton

Fig. 4 Phylogenetic, gene structure, and motif analyses of GhHDZ family a: Phylogenetic relationships between GhHDZ members are based on the full-length protein sequences. b: Gene motif analysis of GhHDZ family. c: Gene structure analysis of GhHDZ family. Gene structure maps were drawn with GSDS. Green boxes indicated exons; grey lines indicated introns. The scale bar is shown at the bottom

Fig. 5 Function types and number of cis-regulatory elements of GhHDZ gene family

Fig. 6 Expression patterns of GhHDZ family genes under abiotic stress

Fig. 7 Relative expressions of 10 GhHDZs to abiotic stress at different time

Fig. 8 Subcellular localizations of GhHDZ146 proteins in tobacco leaves (Bar= 50 μm)

Fig. 9 Salt stress identification of GhHDZ146 overexpression in Arabidopsis thaliana a and b: Comparison of root length between GhHDZ146-OE and WT. Bar=1 cm. c and d: Comparison of root hair length between GhHDZ146-OE and WT. Bar= 50 μm. The difference was analyzed by double-tailed t-test. The error line represents the average ±SD. Among them, WT represents wild type and OE represents GhHDZ146 overexpression strain. * P < 0.05，** P < 0.01

Fig. 10 Clustering of GhHDZ146 and known functional genes in other species

References 67

[1]	Du XM, Huang G, He SP, et al. Resequencing of 243 diploid cotton accessions based on an updated A genome identifies the genetic basis of key agronomic traits[J]. Nat Genet, 2018, 50(6): 796-802. doi: 10.1038/s41588-018-0116-x pmid: 29736014
[2]	Paterson AH, Wendel JF, Gundlach H, et al. Repeated polyploidization of Gossypium genomes and the evolution of spinnable cotton fibres[J]. Nature, 2012, 492(7429): 423-427. doi: 10.1038/nature11798
[3]	Wang KB, Wang ZW, Li FG, et al. The draft genome of a diploid cotton Gossypium raimondii[J]. Nat Genet, 2012, 44(10): 1098-1103. doi: 10.1038/ng.2371
[4]	Yuan DJ, Tang ZH, Wang MJ, et al. The genome sequence of Sea-Island cotton(Gossypium barbadense)provides insights into the allopolyploidization and development of superior spinnable fibres[J]. Sci Rep, 2015, 5: 17662. doi: 10.1038/srep17662
[5]	Zhang TZ, Hu Y, Jiang WK, et al. Sequencing of allotetraploid cotton(Gossypium hirsutum L. acc. TM-1)provides a resource for fiber improvement[J]. Nat Biotechnol, 2015, 33(5): 531-537. doi: 10.1038/nbt.3207
[6]	Wang MJ, Tu LL, Yuan DJ, et al. Reference genome sequences of two cultivated allotetraploid cottons, Gossypium hirsutum and Gossypium barbadense[J]. Nat Genet, 2019, 51(2): 224-229. doi: 10.1038/s41588-018-0282-x
[7]	Chen ZJ, Sreedasyam A, Ando A, et al. Genomic diversifications of five Gossypium allopolyploid species and their impact on cotton improvement[J]. Nat Genet, 2020, 52(5): 525-533. doi: 10.1038/s41588-020-0614-5
[8]	Huang G, Wu ZG, Percy RG, et al. Genome sequence of Gossypium herbaceum and genome updates of Gossypium arboreum and Gossypium hirsutum provide insights into cotton A-genome evolution[J]. Nat Genet, 2020, 52(5): 516-524. doi: 10.1038/s41588-020-0607-4 pmid: 32284579
[9]	Vollbrecht E, Veit B, Sinha N, et al. The developmental gene Knotted-1 is a member of a maize homeobox gene family[J]. Nature, 1991, 350(6315): 241-243. doi: 10.1038/350241a0
[10]	Ariel FD, Manavella PA, Dezar CA, et al. The true story of the HD-Zip family[J]. Trends Plant Sci, 2007, 12(9): 419-426. doi: 10.1016/j.tplants.2007.08.003 pmid: 17698401
[11]	Agalou A, Purwantomo S, Overnäs E, et al. A genome-wide survey of HD-Zip genes in rice and analysis of drought-responsive family members[J]. Plant Mol Biol, 2008, 66(1/2): 87-103. doi: 10.1007/s11103-007-9255-7 URL
[12]	Yue H, Shu DT, Wang M, et al. Genome-wide identification and expression analysis of the HD-zip gene family in wheat(Triticum aestivum L.)[J]. Genes, 2018, 9(2): 70. doi: 10.3390/genes9020070 URL
[13]	梁思维, 姜昊梁, 翟立红, 等. 玉米HD-ZIP I亚家族基因鉴定及表达分析[J]. 作物学报, 2020, 46(4): 532-543. doi: 10.3724/SP.J.1006.2020.93040
	Liang SW, Jiang HL, Zhai LH, et al. Genome-wide identification and expression analysis of HD-ZIP I subfamily genes in maize[J]. Acta Agron Sin, 2020, 46(4): 532-543. doi: 10.3724/SP.J.1006.2020.93040
[14]	Li W, Dong JY, Cao MX, et al. Genome-wide identification and characterization of HD-ZIP genes in potato[J]. Gene, 2019, 697: 103-117. doi: S0378-1119(19)30149-0 pmid: 30776460
[15]	Lin ZF, Hong YG, Yin MG, et al. A tomato HD-Zip homeobox protein, LeHB-1, plays an important role in floral organogenesis and ripening[J]. Plant J, 2008, 55(2): 301-310. doi: 10.1111/tpj.2008.55.issue-2 URL
[16]	Manavella PA, Arce AL, Dezar CA, et al. Cross-talk between ethylene and drought signalling pathways is mediated by the sunflower Hahb-4 transcription factor[J]. Plant J, 2006, 48(1): 125-137. doi: 10.1111/j.1365-313X.2006.02865.x pmid: 16972869
[17]	Ariel F, Diet A, Verdenaud M, et al. Environmental regulation of lateral root emergence in Medicago truncatula requires the HD-Zip I transcription factor HB1[J]. Plant Cell, 2010, 22(7): 2171-2183. doi: 10.1105/tpc.110.074823 URL
[18]	Henriksson E, Olsson ASB, Johannesson H, et al. Homeodomain leucine zipper class I genes in Arabidopsis expression patterns and phylogenetic relationships[J]. Plant Physiol, 2005, 139(1): 509-518. doi: 10.1104/pp.105.063461 pmid: 16055682
[19]	关淑艳, 焦鹏, 蒋振忠, 等. MYB转录因子在植物非生物胁迫中的研究进展[J]. 吉林农业大学学报, 2019, 41(3): 253-260.
	Guan SY, Jiao P, Jiang ZZ, et al. Research progress of MYB transcription factors in plant abiotic stress[J]. J Jilin Agric Univ, 2019, 41(3): 253-260.
[20]	Himmelbach A, Hoffmann T, Leube M, et al. Homeodomain protein ATHB6 is a target of the protein phosphatase ABI1 and regulates hormone responses in Arabidopsis[J]. EMBO J, 2002, 21(12): 3029-3038. pmid: 12065416
[21]	Romani F, Reinheimer R, Florent SN, et al. Evolutionary history of homeodomain leucine zipper transcription factors during plant transition to land[J]. New Phytol, 2018, 219(1): 408-421. doi: 10.1111/nph.15133 pmid: 29635737
[22]	Valdés AE, Overnäs E, Johansson H, et al. The homeodomain-leucine zipper(HD-Zip)class I transcription factors ATHB7 and ATHB12 modulate abscisic acid signalling by regulating protein phosphatase 2C and abscisic acid receptor gene activities[J]. Plant Mol Biol, 2012, 80(4/5): 405-418. doi: 10.1007/s11103-012-9956-4 URL
[23]	Zhang SX, Haider I, Kohlen W, et al. Function of the HD-Zip I gene Oshox22 in ABA-mediated drought and salt tolerances in rice[J]. Plant Mol Biol, 2012, 80(6): 571-585. doi: 10.1007/s11103-012-9967-1 pmid: 23109182
[24]	Elhiti M, Stasolla C. Structure and function of homodomain-leucine zipper(HD-Zip)proteins[J]. Plant Signal Behav, 2009, 4(2): 86-88. doi: 10.4161/psb.4.2.7692 URL
[25]	Franklin KA, Praekelt U, Stoddart WM, et al. Phytochromes B, D, and E act redundantly to control multiple physiological responses in Arabidopsis[J]. Plant Physiol, 2003, 131(3): 1340-1346. doi: 10.1104/pp.102.015487 pmid: 12644683
[26]	He GH, Liu P, Zhao HX, et al. The HD-ZIP II transcription factors regulate plant architecture through the auxin pathway[J]. Int J Mol Sci, 2020, 21(9): 3250. doi: 10.3390/ijms21093250 URL
[27]	Sessa G, Carabelli M, Sassi M, et al. A dynamic balance between gene activation and repression regulates the shade avoidance response in Arabidopsis[J]. Genes Dev, 2005, 19(23): 2811-2815. doi: 10.1101/gad.364005 URL
[28]	Sawa S, Ohgishi M, Goda H, et al. The HAT2 gene, a member of the HD-Zip gene family, isolated as an auxin inducible gene by DNA microarray screening, affects auxin response in Arabidopsis[J]. Plant J, 2002, 32(6): 1011-1022. doi: 10.1046/j.1365-313X.2002.01488.x URL
[29]	Park MY, Kim SA, Lee SJ, et al. ATHB17 is a positive regulator of abscisic acid response during early seedling growth[J]. Mol Cells, 2013, 35(2): 125-133. doi: 10.1007/s10059-013-2245-5 pmid: 23456334
[30]	Prigge MJ, Otsuga D, Alonso JM, et al. Class III homeodomain-leucine zipper gene family members have overlapping, antagonistic, and distinct roles in Arabidopsis development[J]. Plant Cell, 2005, 17(1): 61-76. doi: 10.1105/tpc.104.026161 URL
[31]	Emery JF, Floyd SK, Alvarez J, et al. Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes[J]. Curr Biol, 2003, 13(20): 1768-1774. doi: 10.1016/j.cub.2003.09.035 pmid: 14561401
[32]	Baima S, Possenti M, Matteucci A, et al. The Arabidopsis ATHB-8 HD-zip protein acts as a differentiation-promoting transcription factor of the vascular meristems[J]. Plant Physiol, 2001, 126(2): 643-655. doi: 10.1104/pp.126.2.643 pmid: 11402194
[33]	Szymanski DB, Jilk RA, Pollock SM, et al. Control of GL2 expression in Arabidopsis leaves and trichomes[J]. Development, 1998, 125(7): 1161-1171. doi: 10.1242/dev.125.7.1161 pmid: 9477315
[34]	Peterson KM, Shyu C, Burr CA, et al. Arabidopsis homeodomain-leucine zipper IV proteins promote stomatal development and ectopically induce stomata beyond the epidermis[J]. Development, 2013, 140(9): 1924-1935. doi: 10.1242/dev.090209 pmid: 23515473
[35]	Mabuchi A, Soga K, Wakabayashi K, et al. Phenotypic screening of Arabidopsis T-DNA insertion lines for cell wall mechanical properties revealed ANTHOCYANINLESS2, a cell wall-related gene[J]. J Plant Physiol, 2016, 191: 29-35.
[36]	Walford SA, Wu YR, Llewellyn DJ, et al. Epidermal cell differentiation in cotton mediated by the homeodomain leucine zipper gene, GhHD-1[J]. Plant J, 2012, 71(3): 464-478. doi: 10.1111/tpj.2012.71.issue-3 URL
[37]	Ding MQ, Ye WW, Lin LF, et al. The hairless stem phenotype of cotton(Gossypium barbadense)is linked to a Copia-like retrotransposon insertion in a homeodomain-leucine zipper gene(HD1)[J]. Genetics, 2015, 201(1): 143-154. doi: 10.1534/genetics.115.178236 URL
[38]	Tang ML, Wu XC, Cao YF, et al. Preferential insertion of a Ty1 LTR-retrotransposon into the A sub-genome's HD1 gene significantly correlated with the reduction in stem trichomes of tetraploid cotton[J]. Mol Genet Genomics, 2020, 295(1): 47-54. doi: 10.1007/s00438-019-01602-7
[39]	Guan XY, Pang MX, Nah G, et al. miR828 and miR858 regulate homoeologous MYB2 gene functions in Arabidopsis trichome and cotton fibre development[J]. Nat Commun, 2014, 5: 3050. doi: 10.1038/ncomms4050
[40]	Shan CM, Shangguan XX, Zhao B, et al. Control of cotton fibre elongation by a homeodomain transcription factor GhHOX3[J]. Nat Commun, 2014, 5: 5519. doi: 10.1038/ncomms6519
[41]	Lu SN, Wang JY, Chitsaz F, et al. CDD/SPARCLE: the conserved domain database in 2020[J]. Nucleic Acids Res, 2020, 48(D1): D265-D268. doi: 10.1093/nar/gkz991 URL
[42]	Gasteiger E, Gattiker A, Hoogland C, et al. ExPASy: the proteomics server for in-depth protein knowledge and analysis[J]. Nucleic Acids Res, 2003, 31(13): 3784-3788. doi: 10.1093/nar/gkg563 pmid: 12824418
[43]	Horton P, Park KJ, Obayashi T, et al. WoLF PSORT: protein localization predictor[J]. Nucleic Acids Res, 2007, 35(Web Server issue): W585-W587. doi: 10.1093/nar/gkm259 pmid: 17517783
[44]	Yu CS, Chen YC, Lu CH, et al. Prediction of protein subcellular localization[J]. Proteins, 2006, 64(3): 643-651. doi: 10.1002/prot.v64:3 URL
[45]	Aiyar A. The use of CLUSTAL W and CLUSTAL X for multiple sequence alignment[J]. Methods Mol Biol, 2000, 132: 221-241. pmid: 10547838
[46]	Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets[J]. Mol Biol Evol, 2016, 33(7): 1870-1874. doi: 10.1093/molbev/msw054 pmid: 27004904
[47]	Bailey TL, Boden M, Buske FA, et al. MEME SUITE: tools for motif discovery and searching[J]. Nucleic Acids Res, 2009, 37(Web Server issue): W202-W208. doi: 10.1093/nar/gkp335 URL
[48]	Hu B, Jin JP, Guo AY, et al. GSDS 2.0: an upgraded gene feature visualization server[J]. Bioinformatics, 2015, 31(8): 1296-1297. doi: 10.1093/bioinformatics/btu817 pmid: 25504850
[49]	Chen CJ, Chen H, Zhang Y, et al. TBtools: an integrative toolkit developed for interactive analyses of big biological data[J]. Mol Plant, 2020, 13(8): 1194-1202. doi: S1674-2052(20)30187-8 pmid: 32585190
[50]	Lescot M, Déhais P, Thijs G, et al. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences[J]. Nucleic Acids Res, 2002, 30(1): 325-327. doi: 10.1093/nar/30.1.325 pmid: 11752327
[51]	Wang YP, Tang HB, Debarry JD, et al. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity[J]. Nucleic Acids Res, 2012, 40(7): e49. doi: 10.1093/nar/gkr1293 URL
[52]	Wang DP, Zhang YB, Zhang Z, et al. KaKs_Calculator 2.0: a toolkit incorporating gamma-series methods and sliding window strategies[J]. Genomics Proteomics Bioinformatics, 2010, 8(1): 77-80. doi: 10.1016/S1672-0229(10)60008-3 URL
[53]	Wu CC, Xiao SP, Zuo DY, et al. Genome-wide analysis elucidates the roles of GhHMA genes in different abiotic stresses and fiber development in upland cotton[J]. Plant Physiol Biochem, 2023, 194: 281-301. doi: 10.1016/j.plaphy.2022.11.022 URL
[54]	Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T)method[J]. Nat Protoc, 2008, 3(6): 1101-1108. doi: 10.1038/nprot.2008.73 pmid: 18546601
[55]	Sparkes IA, Runions J, Kearns A, et al. Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants[J]. Nat Protoc, 2006, 1(4): 2019-2025. doi: 10.1038/nprot.2006.286 pmid: 17487191
[56]	Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana[J]. Plant J, 1998, 16(6): 735-743. doi: 10.1046/j.1365-313x.1998.00343.x pmid: 10069079
[57]	付艳茹, 须健. 基于Image J软件的水稻根毛长度测量[J]. 湖北农业科学, 2015, 54(7): 1722-1725.
	Fu YR, Xu J. Length measurement of the root hairs in rice based on image J software[J]. Hubei Agric Sci, 2015, 54(7): 1722-1725.
[58]	Jain M, Tyagi AK, Khurana JP. Genome-wide identification, classification, evolutionary expansion and expression analyses of homeobox genes in rice[J]. FEBS J, 2008, 275(11): 2845-2861. doi: 10.1111/j.1742-4658.2008.06424.x pmid: 18430022
[59]	Li ZQ, Zhang C, Guo YR, et al. Evolution and expression analysis reveal the potential role of the HD-Zip gene family in regulation of embryo abortion in grapes(Vitis vinifera L.)[J]. BMC Genomics, 2017, 18(1): 744. doi: 10.1186/s12864-017-4110-y URL
[60]	Chen X, Chen Z, Zhao HL, et al. Genome-wide analysis of soybean HD-Zip gene family and expression profiling under salinity and drought treatments[J]. PLoS One, 2014, 9(2): e87156. doi: 10.1371/journal.pone.0087156 URL
[61]	Belamkar V, Weeks NT, Bharti AK, et al. Comprehensive characterization and RNA-Seq profiling of the HD-Zip transcription factor family in soybean(Glycine max)during dehydration and salt stress[J]. BMC Genomics, 2014, 15: 950. doi: 10.1186/1471-2164-15-950 pmid: 25362847
[62]	Ding ZH, Fu LL, Yan Y, et al. Genome-wide characterization and expression profiling of HD-Zip gene family related to abiotic stress in cassava[J]. PLoS One, 2017, 12(3): e0173043. doi: 10.1371/journal.pone.0173043 URL
[63]	Shen W, Li H, Teng RM, et al. Genomic and transcriptomic analyses of HD-Zip family transcription factors and their responses to abiotic stress in tea plant(Camellia sinensis)[J]. Genomics, 2019, 111(5): 1142-1151. doi: S0888-7543(18)30262-3 pmid: 30031053
[64]	Wei MY, Liu AL, Zhang YJ, et al. Genome-wide characterization and expression analysis of the HD-Zip gene family in response to drought and salinity stresses in sesame[J]. BMC Genomics, 2019, 20(1): 748. doi: 10.1186/s12864-019-6091-5 pmid: 31619177
[65]	Xu GX, Guo CC, Shan HY, et al. Divergence of duplicate genes in exon-intron structure[J]. Proc Natl Acad Sci USA, 2012, 109(4): 1187-1192. doi: 10.1073/pnas.1109047109 pmid: 22232673
[66]	Söderman E, Hjellström M, Fahleson J, et al. The HD-Zip gene ATHB6 in Arabidopsis is expressed in developing leaves, roots and carpels and up-regulated by water deficit conditions[J]. Plant Mol Biol, 1999, 40(6): 1073-1083. doi: 10.1023/a:1006267013170 pmid: 10527431
[67]	Ebrahimian-Motlagh S, Ribone PA, Thirumalaikumar VP, et al. JUNGBRUNNEN1 confers drought tolerance downstream of the HD-zip I transcription factor AtHB13[J]. Front Plant Sci, 2017, 8: 2118. doi: 10.3389/fpls.2017.02118 pmid: 29326734