Study on the Function of Terpene Synthase Gene tps2 and Its Promoter Functional Segment in Zea mays

doi:10.13560/j.cnki.biotech.bull.1985.2020-0563

Abstract

Abstract:

Insect pest is the main reason causing the yield and quality of corn reduced. The tps2（terpene synthase 2）gene is inducible by herbivore and TPS2 catalyzes the production of many terpenoids. To analyze the function of tps2 and its expression regulation mechanism,qPCR was used to detect the expression of tps2 under different hormones and armyworm treatments. The transgenic maize TPS2OE was obtained by Agrobacterium-mediated transformation using a tps2 overexpression vector and it was used to study the selective behavior of Asian corn borer. The functional segment of tps2 promoter was tested by transient expression system of maize protoplast. The results showed that plant hormones（JA,SA,and ET）and armyworm induced high expression of tps2;and the expression of tps2 in TPS2OE and the target terpenoids were significantly higher than that in control B73. The number of corn borer eggs on the leaves of TPS2OE and B73 was insignificant,while the larvae on TPS2OE were fewer,and the damage areas were also smaller. The promoter truncation analysis found that the required functional element of the tps2 promoter was between -183 to -129,and there were repressor binding sites between -227 to -183. In summary,tps2 expression is induced by plant hormones and armyworm,and TPS2OE plants have a certain inhibitory effect on the larvae of Asian corn borer. The required functional element of tps2 promoter is between -183 to -129.

Key words: maize, tps2, terpenoids, plant hormones, Asian corn borer, promoter

WANG Dan, LI Sheng-yan, LIU Jin-ping, LANG Zhi-hong. Study on the Function of Terpene Synthase Gene tps2 and Its Promoter Functional Segment in Zea mays[J]. Biotechnology Bulletin, 2020, 36(12): 1-11.

Figures/Tables 11

References 36

[1]	Liu Q, Hallerman E, Peng Y, et al. Development of Bt rice and Bt maize in China and their efficacy in target pest control[J]. International J Molecular Science, 2016,17(10):E1561.
[2]	Chen MS. Inducible direct plant defense against insect herbivores:a review[J]. Insect Science, 2008,15(2):101-114. doi: 10.1111/j.1744-7917.2008.00190.x URL
[3]	Zhuang X, Fiesselmann A, Zhao N, et al. Biosynjournal and emission of insect herbivory-induced volatile indole in rice[J]. Phytochemistry, 2012,73:15-22. doi: 10.1016/j.phytochem.2011.08.029 URL pmid: 22000657
[4]	Hagenbucher S, Olson DM, Ruberson JR, et al. Resistance mechanisms against arthropod herbivores in cotton and their interactions with natural enemies[J]. Critical Reviews in Plant Sciences, 2013,32:458-482. doi: 10.1080/07352689.2013.809293 URL
[5]	Xu S, Zhou W, Pottinger S, et al. Herbivore associated elicitor-induced defences are highly specific among closely related nicotiana species[J]. BMC Plant Biology, 2015,15:2. doi: 10.1186/s12870-014-0406-0 URL pmid: 25592329
[6]	Fontana A, Held M, Fantaye CA, et al. Attractiveness of constitutive and herbivore-induced sesquiterpene blends of maize to the parasitic wasp Cotesia Marginiventris(Cresson)[J]. Journal of Chemical Ecology, 2011,37:582-591. URL pmid: 21607717
[7]	Davidovich-Rikanati R, Sitrit Y, Tadmor Y. Enrichment of tomato flavor by diversion of the early plastidial terpenoid pathway[J]. Nature Biotechnology, 2007,25(8):899-901. doi: 10.1038/nbt1312 URL pmid: 17592476
[8]	Lücker J, Bouwmeester HJ, Schwab W, et al. Expression of clarkia s-linalool synthase in transgenic petunia plants results in the accumulation of s-linalyl-beta-d-glucopyranoside[J]. The Plant Journal, 2001,27(4):315-324. URL pmid: 11532177
[9]	Schnee C, Kollner T, Held M, et al. The products of a single maize sesquiterpene synthase form a volatile defense signal that attracts natural enemies of maize herbivores[J]. Proceedings of the National Academy of Sciences of the United States of America, 2006,103(4):1129-1134. doi: 10.1073/pnas.0508027103 URL pmid: 16418295
[10]	Kost C, Heil M. Herbivore-induced plant volatiles induce an indirect defence in neighbouring plants[J]. Journal of Ecology, 2006,94:619-628.
[11]	Halitschke R, Schittko U, Pohnert G, et al. Molecular interactions between the specialist hrbivore manduca sexta(lepidoptera, sphingidae)and its natural host Nicotiana Attenuata. III. Fatty acid-amino acid conjugates in herbivore oral secretions are necessary and sufficient for herbivorespecific plant responses[J]. Plant Physiology, 2001,125:711-717. doi: 10.1104/pp.125.2.711 URL pmid: 11161028
[12]	Kessler A, Baldwin IT. Defensive function of herbivore-induced plant volatile emissions in nature[J]. Science, 2001,291:2141-2144. URL pmid: 11251117
[13]	Turlings TCJ, Tumlinson JH, Lewis WJ. Exploitation of herbivore-induced plant odors by host-seeking parasitic wasps[J]. Science, 1990,250(4985):1251-1253. doi: 10.1126/science.250.4985.1251 URL pmid: 17829213
[14]	Li SY, Wang H, Li FQ, et al. The maize transcription factor EREB58 mediates the jasmonate-induced production of sesquiterpene volatiles[J]. Plant Journal, 2015,84(2):296-308.
[15]	Yoshitomi K, Taniguchi S, Tanaka K, et al. Rice terpene synthase 24(OsTPS24)encodes a jasmonate-responsive monoterpene synthase that produces an antibacterial γ-terpinene against rice pathogen[J]. Journal of Plant Physiology, 2015,191:120-126. URL pmid: 26771167
[16]	Benedetti M, Pontiggia D, Raggi S. et al. Plant immunity triggered by engineered in vivo release of oligogalacturonides, damage-associated molecular patterns[J]. Proceedings of the National Academy of Sciences of the United States of America, 2015,112:5533-5538. doi: 10.1073/pnas.1504154112 URL pmid: 25870275
[17]	Ozawa R, Arimura G, Takabayashi J, et al. Involvement of jasmonate- and salicylate-related signaling pathways for the production of specific herbivore-induced volatiles in plants[J]. Plant & Cell Physiology, 2000,41:391-398. doi: 10.1093/pcp/41.4.391 URL pmid: 10845451
[18]	Shain L, Hillis W. Ethylene production in pinus radiata in response to sirex-amylostereum attack[J]. Phytopathology, 1972,62:1407-1409.
[19]	Kendall D, Bjostad L. Phytohormone ecology-herbivory by thrips tabaci induces greater ethylene production in intact onions than mechanical damage alone[J]. Journal of Chemical Eecology, 1990,16:981-991.
[20]	O’Donnell P, Calvert C, Atzorn R, et al. Ethylene as a signal mediating the wound response of tomato plants[J]. Science, 1996,274(5294):1914-1917. URL pmid: 8943205
[21]	Schmelz EA, Alborn HT, Banchio E, et al. Quantitative relationships between induced jasmonic acid levels and volatile emission in Zea Mays during Spodoptera exigua herbivory[J]. Planta, 2003,216:665-673. doi: 10.1007/s00425-002-0898-y URL pmid: 12569409
[22]	Richter A, Schaff C, Zhang Z, et al. Characterization of biosynthetic pathways for the production of the volatile homoterpenes DMNT and TMTT in Zea Mays[J]. Plant Cell, 2016,28:2651-2665. doi: 10.1105/tpc.15.00919 URL pmid: 27662898
[23]	Dicke M, Beek TAV, Posthumus MA, et al. Isolation and identification of volatile kairomone that affects acarine predatorprey interactions involvement of host plant in its production[J]. Journal of Chemical Ecology, 1990,16(2):381-396. doi: 10.1007/BF01021772 URL pmid: 24263497
[24]	李圣彦 . 玉米萜类合成酶基因tps10表达调控的研究[D]. 北京:中国农业大学, 2015.
	Li SY . The expression regulation of terpene synthases gene tps10 in Zea mays[D]. Beijing: China Agricultural University, 2015.
[25]	Dempsey D, Vlot A, Wildermuth MC, et al. Salicylic acid biosynjournal and netabolism[J]. Arabidopsis Book, 2011,9:E0156. URL pmid: 22303280
[26]	Pieterse C, Van der Does D, Zamioudis C, et al. Hormonal modulation of plant immunity[J]. Annual Review of Cell and Developmental Biology, 2012,28:489-521. URL pmid: 22559264
[27]	Atamian HS, Harmer SL. Circadian regulation of hormone signaling and plant physiology[J]. Plant Molecular Biology, 2016,91:691-702. URL pmid: 27061301
[28]	Druege U, Franken P, Hajirezaei MR. Plant hormone homeostasis, signaling, and function during adventitious root formation in cuttings[J]. Frontiers in Plant Science, 2016,7:E381.
[29]	Li N, Han X, Feng D, et al. Signaling crosstalk between salicylic acid and ethylene/jasmonate in plant defense:do we understand what they are whispering?[J]. International Journal of Molecular Sciences, 2019,20(3):E671. URL pmid: 30720746
[30]	Verma V, Ravindran P, Kumar P. Plant hormone-mediated regulation of stress responses[J]. BMC Plant Biology, 2016,16(1):1-10
[31]	Spoel SH, Johnson JS, Dong X. Regulation of tradeoffs between plant defenses against pathogens with different lifestyles[J]. Proceedings of the National Academy of Sciences of the United States of America, 2007,104(47):18842-18847. URL pmid: 17998535
[32]	Bruce TJ, Matthes MC, Chamberlain K, et al. cis-Jasmone induces Arabidopsis genes that affect the chemical ecology of multitrophic interactions with aphids and their parasitoids[J]. Proceedings of the National Academy of Sciences of the United States of America, 2008,105(12):4553-4558. doi: 10.1073/pnas.0710305105 URL pmid: 18356298
[33]	Liu D, Huang X, Jing W, et al. Identification and functional analysis of two P450 enzymes of Gossypium hirsutum involved in DMNT and TMTT biosynjournal[J]. Plant Biotechnology Journal, 2017,16:581-590 doi: 10.1111/pbi.12797 URL pmid: 28710782
[34]	Arimura GI, Ozawa R, Shimoda T, et al. Herbivory-induced volatiles elicit defence genes in Lima bean leaves[J]. Nature, 2000,406(6795):512-515. doi: 10.1038/35020072 URL pmid: 10952311
[35]	Chen J, Zeng B, Zhang M, et al. Dynamic transcriptome landscape of maize embryo and endosperm development[J]. Plant Physiology, 2014,166(1):252-264. URL pmid: 25037214
[36]	Gisselbrecht SS, Palagi A, Kurland JV, et al. Transcriptional silencers in drosophila serve a dual role as transcriptional enhancers in alternate cellular contexts[J]. Molecular Cell, 2020,77(2):324-337. doi: 10.1016/j.molcel.2019.10.004 URL

引物名称	引物序列（5'-3'）
tps2Pwf-R	GCGGCCGCTCTAGAACTAGTGGATCCCGTCT- ACTACTCGAACTAACTGAAC
tps2Pwf968-F	TCGAGGTCGACGGTATCGATAAGCTTGTAC- ACACATCATCAATAAG
tps2Pwf737-F	TCGAGGTCGACGGTATCGATAAGCTTAACTG- TGGTCGTCGCAAT
tps2Pwf485-F	TCGAGGTCGACGGTATCGATAAGCTTCGTTTT- TTTATCCATTGC
tps2Pwf327-F	TCGAGGTCGACGGTATCGATAAGCTTCTGTA- TGCCCTGACCTGA
tps2Pwf227-F	TCGAGGTCGACGGTATCGATAAGCTTCTGGC- ATCGGAAGAAGCT
tps2Pwf183-F	TCGAGGTCGACGGTATCGATAAGCTTTCGCC- CTATAAATTGGAG
tps2Pwf129-F	TCGAGGTCGACGGTATCGATAAGCTTTCACA- ACACAAGCAGGCA
tps2Pwf61-F	TCGAGGTCGACGGTATCGATAAGCTTGGCTTG- CTTTGGTTTCTG

引物名称	引物序列（5'-3'）
tps2Pwf-R	GCGGCCGCTCTAGAACTAGTGGATCCCGTCT- ACTACTCGAACTAACTGAAC
tps2Pwf968-F	TCGAGGTCGACGGTATCGATAAGCTTGTAC- ACACATCATCAATAAG
tps2Pwf737-F	TCGAGGTCGACGGTATCGATAAGCTTAACTG- TGGTCGTCGCAAT
tps2Pwf485-F	TCGAGGTCGACGGTATCGATAAGCTTCGTTTT- TTTATCCATTGC
tps2Pwf327-F	TCGAGGTCGACGGTATCGATAAGCTTCTGTA- TGCCCTGACCTGA
tps2Pwf227-F	TCGAGGTCGACGGTATCGATAAGCTTCTGGC- ATCGGAAGAAGCT
tps2Pwf183-F	TCGAGGTCGACGGTATCGATAAGCTTTCGCC- CTATAAATTGGAG
tps2Pwf129-F	TCGAGGTCGACGGTATCGATAAGCTTTCACA- ACACAAGCAGGCA
tps2Pwf61-F	TCGAGGTCGACGGTATCGATAAGCTTGGCTTG- CTTTGGTTTCTG