Establishment and Functional Validation of a Reverse Genetics System for the Chinese Influenza D Virus D/JY3002

doi:10.13560/j.cnki.biotech.bull.1985.2025-0496

Abstract

Abstract:

Objective The current prevalent influenza D virus in Chinese cattle herds primarily belongs to the D/Yama2019 genetic lineage. The development of a reverse genetics system for the D/Yama2019 genetic lineage influenza D virus offers a crucial research tool for the in-depth investigation of its replication and pathogenic mechanisms. Method The Chinese influenza D virus strain D/bovine/CHN/JY3002/2022 (Abbreviated as D/JY3002), belonging to the D/Yama2019 genetic lineage, was utilized as the research material. The DNA fragments corresponding to the genomic segments that encode the primary antigen of the virus, Hemagglutinin-Esterase-Fusion (HEF), were successfully cloned into the engineered bidirectional expression vector pCC1-DualPro. The DNA fragments corresponding to the remaining genomic segments were seamlessly cloned into the widely utilized bidirectional expression vector pHW2000. Subsequently, the recombinant influenza D virus was successfully rescued through improved and optimized operational procedures. Result The rescued influenza D virus strain (rD/JY3002) demonstrated a replication ability comparable to that of the naturally isolated Chinese influenza D virus strain (D/JY3002), and the replication kinetics of the two viruses are similar. Moreover, the rD/JY3002 virus can be stably propagated for at least five generations. Using the established reverse genetics system, recombinant influenza D viruses containing the green fluorescence reporter gene (GFP) and the HEF genes from other genetic lineages (D/OK and D/660) were successfully generated. They were respectively designated as rD/JY3002-GFP, rD/JY3002-D/OK-HEF, and rD/JY3002-D/660-HEF. These results confirmed that reassortment occurred among influenza D viruses from different genetic lineages. Conclusion An efficient and stable reverse genetics system for the influenza D virus Chinese strain has been established. This system can be utilized to further advance exogenous gene presentation technology, employing the influenza D virus as a vector.

Key words: influenza D virus, reverse genetics system, genomic segment, vector

HU Wan-ke, CHEN Yun-xia, LUO Di-zhou, WU Si-yu, LI Jian-bo, ZHAI Shao-lun, JU Xiang-hong, LIAO Ming, WEI Wen-kang, YU Jie-shi. Establishment and Functional Validation of a Reverse Genetics System for the Chinese Influenza D Virus D/JY3002[J]. Biotechnology Bulletin, 2025, 41(12): 95-105.

Figures/Tables 6

Fig. 1 5′-and 3′-end sequences of genomic segments of influenza D virusesA-G illustrate 100 bp sequences at 5'- and 3'-end of genomic segments (PB2, PB1, P3, HEF, NP, M, and NS) of influenza D viruses that belong to different genetic lineages (D/OK, D/660, and D/Yama2019). The first and second rows in each sequence alignment diagram refer to terminal sequences of genomic segments from the D/OK and D/660 strains, respectively. The third row displays the terminal sequences of the D/JY3002 genomic segment, which have been reported but are incomplete. The fourth row presents the complete terminal sequence of the D/JY3002 genomic segment obtained in this study. The red box in the illustration highlights the sequences of the non-coding regions at both ends of genomic segments of influenza D viruses

Table 1 Primers for amplifying target fragments and linearization of vectors

Number	Primer name	Primer sequence（5'-3'）
1	D/JY3002-PB2-F	AGCATAAGCAGAGGATGTCACTACTATTAACGC
2	D/JY3002-PB2-R	CCGCCGGGTTATTAGCAGTAGCAAGAGGATTTTTTCAATGTG
3	D/JY3002-PB1-F	GGAGCATAAGCAGAGGATTTTATAACAATGGA
4	D/JY3002-PB1-R	CCGCCGGGTTATTAGCAGTAGCAAGAGGATTTTTC
5	D/JY3002-P3-F	AGCATAAGCAGGAGATTTAGAAATGTCTAGTAT
6	D/JY3002-P3-R	CCGCCGGGTTATTAGCAGTAGCAAGGAGATTTTTAA
7	D/JY3002-HEF-F	AGCATAAGCAGGAGATTTTCAAAGATGTTTTTG
8	D/JY3002-HEF-R	CCGCCGGGTTATTAGCAGTAGCAAGGAGATTTTTTCTAAGAT
9	D/JY3002-NP-F	AGCATAAGCAGGAGATTATTAAGCAATATGGAC
10	D/JY3002-NP-R	CCGCCGGGTTATTAGCAGTAGCAAGGAGATTTTTTGTTAAAT
11	D/JY3002-M-F	GGAGCATAAGCAGAGGATATTTTTGACGCAATG
12	D/JY3002-M-R	CCGCCGGGTTATTAGCAGTAGCAAGAGGATTTTTTCGCGA
13	D/JY3002-NS-F	GGAGCATAAGCAGGGGTGTACAATTTCAATATG
14	D/JY3002-NS-R	CCGCCGGGTTATTAGCAGTAGCAAGGGGTTTTTTCATACT
15	pHW2000-F	TACTGCTAATAACCCGGCGGCCCAAAATGCCG
16	pHW2000-PB2-R	TGACATCCTCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA
17	pHW2000-PB1-R	AAATCCTCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA
18	pHW2000-P3-R	CTAAATCTCCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA
19	pHW2000-HEF-R	GAAAATCTCCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA
20	pHW2000-NP-R	AATAATCTCCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA
21	pHW2000-M-R	ATATCCTCTGCTTATGCTCCCCCCCAAACTTCGGAGGTCGA
22	pHW2000-NS-R	TACACCCCTGCTTATGCTCCCCCCCAACTTCGGAGGTCGA

Fig. 2 Construction of bidirectional expression plasmids containing DNA fragments corresponding to the D/JY3002 genomic segmentsA: Gel electrophoresis plots of amplified DNA fragments corresponding to the full-length genomic segments PB2 (2 364 bp), PB1 (2 330 bp), P3 (2 195 bp), HEF (2 049 bp), NP (1 775 bp), M (1 219 bp) and NS (868 bp) of the D/JY3002. B: The map of bidirectional plasmid pHW2000 containing the DNA fragment corresponding to the full-length genomic segment PB2, PB1, P3, NP, M or NS of the D/JY3002.C: The DNA fragment corresponding to the D/JY3002 HEF genomic segment was ligated to the pHW2000 vector through seamless cloning technology. The colonies obtained after transformation were identified by PCR and analyzed by gel electrophoresis. Among them, lane 1 to 7 indicate 7 different colony samples respectively. D: The map of designed bidirectional plasmid pCC1-DualPro containing the DNA fragment corresponding to the full-length genomic segment HEF of the D/JY3002. E: The DNA fragment corresponding to the D/JY3002 HEF genomic segment was ligated to the pCC1-DualPro vector through seamless cloning technology. The colonies obtained after transformation were identified by PCR and analyzed by gel electrophoresis. Among them, lane 1 and 2 indicate 2 different colony samples. F: Gel electrophoresis analysis was performed on all the extracted bidirectional expression plasmids. Lane 1 to 7 are pHW2000-D/JY3002-PB2 (5 377 bp), -PB1 (5 343 bp), -P3 (5 208 bp), -NP (4 788 bp), -M (4 232 bp), -NS (3 881 bp), and pCC1-DualPro-D/JY3002-HEF (11 105 bp), respectively. Marker, used to indicate the size of the DNA fragment

Fig. 3 Comparative analysis of the replication capacity and growth kinetics of artificially rescued rD/JY3002 and wild-type D/JY3002 influenza D virusesA: Replication titers (TCID50/mL) of the rescued rD/JY3002 and naturally isolated D/JY3002. B: Growth curves of rD/JY3002 and D/JY3002. C: Replication titers of different passages of rD/JY3002 (P1, P2, P3, P4 and P5). The infection dose was 0.01 MOI, and "ns" indicates no significant difference. * : P<0.05; ** : P<0.01 *** : P<0.001

Fig. 4 Artificial rescue of the rD/JY3002-GFP and expression analysis of the GFPA: Design and construction of the unidirectional expression plasmid pPolI-D/JY3002-PB1-240-GFP-240 (schematic diagram). B: Replication titers (TCID50/mL) of different passages of rD/JY3002-GFP viruses. C: Fluorescence images of MDCK cells infected with different passages of rD/JY3002-GFP viruses. Mock/Infected: Uninfected/Infected cells, and the infection dose is 0.01 MOI

Fig. 5 Construction of recombinant influenza D viruses containing the heterologous HEF gene and analysis of their antigenic cross-reactivityA: Schematic diagrams of recombinant influenza D viruses rD/JY3002, rD/JY3002-D/OK-HEF and rD/JY3002-D/660-HEF. B: Growth kinetics of rD/JY3002, rD/JY3002-D/OK-HEF and rD/JY3002-D/660-HEF on MDCK cells. C: HI titers of rabbit anti-D/JY3002 sera against recombinant influenza D viruses rD/JY3002, rD/JY3002-D/OK-HEF and rD/JY3002-D/660-HEF

References 29

[1]	Hause BM, Ducatez M, Collin EA, et al. Isolation of a novel swine influenza virus from Oklahoma in 2011 which is distantly related to human influenza C viruses [J]. PLoS Pathog, 2013, 9(2): e1003176.
[2]	Hause BM, Collin EA, Liu RX, et al. Characterization of a novel influenza virus in cattle and swine: proposal for a new genus in the Orthomyxoviridae Family [J]. mBio, 2014, 5(2): e00031-14.
[3]	Collin EA, Sheng ZZ, Lang YK, et al. Cocirculation of two distinct genetic and antigenic lineages of proposed influenza D virus in cattle [J]. J Virol, 2015, 89(2): 1036-1042.
[4]	Ferguson L, Olivier AK, Genova S, et al. Pathogenesis of influenza D virus in cattle [J]. J Virol, 2016, 90(12): 5636-5642.
[5]	Yu JS, Li F, Wang D. The first decade of research advances in influenza D virus [J]. J Gen Virol, 2021, 102(1).
[6]	Trombetta CM, Marchi S, Marotta MG, et al. Detection of influenza D antibodies in dogs, Apulia Region, Italy, 2016 and 2023 [J]. Emerg Infect Dis, 2024, 30(5): 1045-1047.
[7]	Guan MH, Jacobson O, Sarafianos G, et al. Exposure of white-tailed deer in North America to influenza D virus [J]. Virology, 2022, 573: 111-117.
[8]	Yu JS, Hika B, Liu RX, et al. The hemagglutinin-esterase fusion glycoprotein is a primary determinant of the exceptional thermal and acid stability of influenza D virus [J]. mSphere, 2017, 2(4)
[9]	Huang C, Yu JS, Hause BM, et al. Emergence of new phylogenetic lineage of Influenza D virus with broad antigenicity in California, United States [J]. Emerg Microbes Infect, 2021, 10(1): 739-742.
[10]	Yu JS, Li TY, Wen ZY, et al. Identification of D/Yama2019 lineage-like influenza D virus in Chinese cattle [J]. Front Vet Sci, 2022, 9: 939456.
[11]	Yu JS, Wen ZY, Hu WK, et al. Influenza D virus infection in China, 2022-2023 [J]. Emerg Microbes Infect, 2024, 13(1): 2343907.
[12]	Yu JS, Liu RX, Zhou B, et al. Development and characterization of a reverse-genetics system for influenza D virus [J]. J Virol, 2019, 93(21): e01186-19.
[13]	Ishida H, Murakami S, Kamiki H, et al. Establishment of a reverse genetics system for influenza D virus [J]. J Virol, 2020, 94(10): e01767-19.
[14]	Holwerda M, Laloli L, Wider M, et al. Establishment of a reverse genetic system from a bovine derived influenza D virus isolate [J]. Viruses, 2021, 13(3): 502.
[15]	Murakami S, Sato R, Ishida H, et al. Influenza D virus of new phylogenetic lineage, Japan [J]. Emerg Infect Dis, 2020, 26(1): 168-171.
[16]	Hoffmann E, Neumann G, Kawaoka Y, et al. A DNA transfection system for generation of influenza A virus from eight plasmids [J]. Proc Natl Acad Sci U S A, 2000, 97(11): 6108-6113.
[17]	Hoffmann E, Mahmood K, Yang CF, et al. Rescue of influenza B virus from eight plasmids [J]. Proc Natl Acad Sci U S A, 2002, 99(17): 11411-11416.
[18]	Crescenzo-Chaigne B, van der Werf S. Rescue of influenza C virus from recombinant DNA [J]. J Virol, 2007, 81(20): 11282-11289.
[19]	Pleschka S, Jaskunas R, Engelhardt OG, et al. A plasmid-based reverse genetics system for influenza A virus [J]. J Virol, 1996, 70(6): 4188-4192.
[20]	Fodor E, Devenish L, Engelhardt OG, et al. Rescue of influenza a virus from recombinant DNA [J]. J Virol, 1999, 73(11): 9679-9682.
[21]	Noda T. Selective genome packaging mechanisms of influenza a viruses [J]. Cold Spring Harb Perspect Med, 2020: a038497.
[22]	Jiang WM, Wang SC, Peng C, et al. Identification of a potential novel type of influenza virus in Bovine in China [J]. Virus Genes, 2014, 49(3): 493-496.
[23]	Zhai SL, Zhang H, Chen SN, et al. Influenza D virus in animal species in Guangdong Province, Southern China [J]. Emerg Infect Dis, 2017, 23(8): 1392-1396.
[24]	He WT, Lu M, Xing G, et al. Emergence and adaptive evolution of influenza D virus [J]. Microb Pathog, 2021, 160: 105193.
[25]	余界石, 魏文康. 丁型流感病毒在中国的流行状况及研究进展 [J]. 广东农业科学, 2022, 49(11): 1-8.
	Yu JS, Wei WK. Epidemiology and research advances of influenza D virus in China [J]. Guangdong Agric Sci, 2022, 49(11): 1-8.
[26]	Gao HB, Sun WY, Lu PY, et al. First isolation of influenza D virus from cattle in Northeast China [J]. Microbiol Spectr, 2024, 12(9): e00374-24.
[27]	Lim EH, Lim SI, Kim MJ, et al. First detection of influenza D virus infection in cattle and pigs in the republic of Korea [J]. Microorganisms, 2023, 11(7): 1751.
[28]	Nakatsu S, Murakami S, Shindo K, et al. Influenza C and D viruses package eight organized ribonucleoprotein complexes [J]. J Virol, 2018, 92(6): e02084-17.
[29]	Nakatsu S, Sagara H, Sakai-Tagawa Y, et al. Complete and incomplete genome packaging of influenza a and B viruses [J]. mBio, 2016, 7(5): e01248-16.