A Quantitative Detection Approach for Glucose Uptake in Aspergillus niger: A Case Study of Glucose Transporter MstC

doi:10.13560/j.cnki.biotech.bull.1985.2023-0759

Abstract

Abstract:

Aspergillus niger is an important strain for industrial production of organic acids and enzymes, possessing a powerful hydrolytic enzyme system and glucose transport system, which enable to copy with extracellular carbon sources variance and uptake glucose to support cell growth and industrial production. As an important carbon source and an essential signaling molecule, glucose and its uptake has considerable influence on cell growth and fermentation performance. Regarding to issue of lacking simple methods for quantitative characterization of glucose absorptive capacity in filamentous fungi, we developed a quantitative detection pipeline for glucose uptake capacity assay for filamentous fungi, using a non-metabolizable, fluorescent glucose analog, 2-（N-（7-nitrobenz-2-oxa-1,3-diazol-4-yl）amino）-2-deoxyglucose（2-NBDG）as a fluorescent probe, then incubating pre-cultured A. niger spores with 2-NBDG, and using with fluorescence microscopy and flow cytometry. It showed that the optimized 2-NBDG work concentration and incubation time were 150 μmol/L and 4 h, respectively. Using this quantitative analysis method, it was found that the overexpression of low affinity glucose transporter MstC increased glucose uptake by 1.44 times. Meanwhile, on the basis of previous studies, mutant R188K of MstC was designed, and the point mutation directly caused the loss of glucose transport activity of MstC, which indicates that Arg188 is a key amino acid site affecting the glucose transport capacity of MstC. The establishment of this quantitative glucose uptake detection method and its application to the study of MstC function not only deepens the quantitative understanding of glucose absorption in filamentous fungi, but also provides technical support for the transformation and optimization of glucose transport system. This study provides a feasible quantitative approach to investigate the glucose uptake of filamentous fungi, and also revealed the physiological function of key glucose transporter MstC, which paves the way for glucose uptake engineering in this industrially important fungal cell factory.

Key words: Aspergillus niger, glucose uptake, 2-NBDG, glucose transporter, MstC, fluorescence imaging, flow cytometry

GAO Kai-yue, GUO Yu-ting, DU Yi-mou, ZHENG Xiao-mei, MA Xin-rong, ZHAO Wei, ZHENG Ping, SUN Ji-bin. A Quantitative Detection Approach for Glucose Uptake in Aspergillus niger: A Case Study of Glucose Transporter MstC[J]. Biotechnology Bulletin, 2023, 39(12): 71-80.

Figures/Tables 8

Table 1 Strains and plasmids used in this study

Strains/Plasmids	Description	Source
Escherichia coli Trans1-T1	F- φ80（lacZ）, ΔM15, ΔlacX74, hsdR（rkmk+）, ΔrecA 1398, endA, tonA	TransGen.
Saccharomyces cerevisiae EBY.VW4000	CEN.PK2-1C, hxt1-17, stl1, agt1, ydl247w, yjr160c, gal2	[12]
S. cerevisiae EBY.MstC	EBY.VW4000 with pRS-MstC	This study
S. cerevisiae EBY.MstC^R188K	EBY.VW4000 with pRS-MstC^R188K	This study
A. niger D353.8	pyrG::hph, kusA::hph, Hyg^R	[13]
A. niger OE. MstC	D353.8 with the PgpdA:mstC expression cassette	This study
A. niger OE. MstC^R188K	D353.8 with the PgpdA:mstC^R188K expression cassette	This study
pRS426	Ppgk:gfp:Tpgk, Ura, Amp^R	[12]
pRS-MstC	pRS426 carring the mstC gene	This study
pRS-MstC^R188K	pRS426 carring the mstC^R188K gene	This study
pXMD7	PgpdA:TtrpC, pyrG, Amp^R	[14]
pOE-MstC	pOE carring PgpdA-mstC expression cassette	This study
pOE-MstC^R188K	pOE carring PgpdA-mstC^R188K expression cassette	This study

Table 2 Primers and their sequences used in this study

Primer name	Primer sequence（5'-3'）	Source
MstC-F1	gcatactagtATGGGTGTCTCTAATATGATGTC	This study
MstC-R1	gcctaagcttCTCGCGGAGCTCAGTGGG	This study
MstC^R188K-F MstC^R188K-R	CTGCTCCCCGTCAGGTCAAGGGTGCCATGGTCAGTGCCTTC CACTGACCATGGCACCCTTGACCTGACGGGGAGCAGATTC	This study
MstC-F2	tcaccggatcccatatgttaattaaATGGGTGTCTCTAATATGATGTC	This study
MstC-R2	atctactcccgggtacgtaactagtCTACTCGCGGAGCTCAGTGGG	This study
pRS-F	TACGACTCACTATAGGGCGAA	This study
pRS-R	AAACAGAATTGTCCGAATCGT	This study

Fig. 1 Effect of 2-NBDG concentration on the glucose uptake in A. niger A-C: The fluorescence imaging of A. niger spores incubated with different concentrations of 2-NBDG. D-F: Flow cytometric detection of A. niger spores incubated with different concentrations of 2-NBDG. A and D: 100 μmol/L 2-NBDG; B and E: 150 μmol/L 2-NBDG; C and F: 200 μmol/L 2-NBDG. FI refers to the average fluorescence intensity of 105 spores. Q2 refers to the proportion of spores with fluorescence intensity FITC-H（>103）to the total spore count, the same below

Fig. 2 Effect of 2-NBDG incubation time on the glucose uptake fluorescence detection in A. niger A-C: The fluorescence imaging of spores incubated 2-NBDG for different incubation time. D-F: Flow cytometric detection of spores incubated 2-NBDG for different incubation time. A and D: 0 h; B and E: 2 h; C and F: 4 h

Fig. 3 Effect of glucose concentration on the cell growth of recombinant E. coli strain EBY.MstC

Fig. 4 Glucose uptake capacity detection based on MstC-overexpressed strain A. niger A-B: The fluorescence imaging of spores incubated 150 μmol/L 2-NBDG for 4 h. C-D: Flow cytometric detection of spores incubated 150 μmol/L 2-NBDG for 4 h.A and C: The parent strain D353.8; B and D: MstC overexpression strain OE.MstC

Fig. 5 Structure analysis and glucose transport capacity detection of MstC A is the sequence structure analysis of glucose transporter protein MstC, and B is the growth of yeast recombinant strains EBY.MstC and EBY.MstCR188K at different glucose concentrations. In multiple sequence alignment, AnMstC and AnMstA represent endogenous glucose transporters MstC and MstA from A. niger, AndMstE represents glucose transporter MstE from A. niger, and NcGlt1, NcHgt1, and NcHgt2 represent glucose transporters Glt1, Hgt1, and Hgt2 from A. niger, respectively

Fig. 6 Glucose uptake capacity detection of A. niger MstC point mutant over-expressed strain OE.MstCR188K A-B: The fluorescence imaging of spores incubated 150 μmol/L 2-NBDG for 4 h. C-D: Flow cytometric detection of spores incubated 150 μmol/L 2-NBDG for 4 h. A, C: The parent strain D353.8; B, D: MstC point mutant overexpression strain MstCR188K

References 18

[1]	Tong ZY, Zheng XM, Tong Y, et al. Systems metabolic engineering for citric acid production by Aspergillus niger in the post-genomic era[J]. Microb Cell Fact, 2019, 18(1): 28. doi: 10.1186/s12934-019-1064-6
[2]	Meyer V, Andersen MR, Brakhage AA, et al. Current challenges of research on filamentous fungi in relation to human welfare and a sustainable bio-economy: a white paper[J]. Fungal Biol Biotechnol, 2016, 3: 6. doi: 10.1186/s40694-016-0024-8 pmid: 28955465
[3]	Torres NV, Riol-Cimas JM, Wolschek M, et al. Glucose transport by Aspergillus niger: the low-affinity carrier is only formed during growth on high glucose concentrations[J]. Appl Microbiol Biotechnol, 1996, 44(6): 790-794.
[4]	de Vries RP, Riley R, Wiebenga A, et al. Comparative genomics reveals high biological diversity and specific adaptations in the industrially and medically important fungal genus Aspergillus[J]. Genome Biol, 2017, 18(1): 28. doi: 10.1186/s13059-017-1151-0
[5]	Vankuyk PA, Diderich JA, MacCabe AP, et al. Aspergillus niger mstA encodes a high-affinity sugar/H⁺ symporter which is regulated in response to extracellular pH[J]. Biochem J, 2004, 379(Pt 2): 375-383. doi: 10.1042/bj20030624 URL
[6]	Jørgensen TR, VanKuyk PA, Poulsen BR, et al. Glucose uptake and growth of glucose-limited chemostat cultures of Aspergillus niger and a disruptant lacking MstA, a high-affinity glucose transporter[J]. Microbiology, 2007, 153(Pt 6): 1963-1973. doi: 10.1099/mic.0.2006/005090-0 pmid: 17526853
[7]	Xu YX, Zhou YT, Cao W, et al. Improved production of malic acid in Aspergillus niger by abolishing citric acid accumulation and enhancing glycolytic flux[J]. ACS Synth Biol, 2020, 9(6): 1418-1425. doi: 10.1021/acssynbio.0c00096 URL
[8]	Bleichrodt RJ, Vinck A, Read ND, et al. Selective transport between heterogeneous hyphal compartments via the plasma membrane lining septal walls of Aspergillus niger[J]. Fungal Genet Biol, 2015, 82: 193-200. doi: 10.1016/j.fgb.2015.06.010 URL
[9]	Roy A, Dement AD, Cho KH, et al. Assessing glucose uptake through the yeast hexose transporter 1(Hxt1)[J]. PLoS One, 2015, 10(3): e0121985. doi: 10.1371/journal.pone.0121985 URL
[10]	Yoshioka K, Takahashi H, Homma T, et al. A novel fluorescent derivative of glucose applicable to the assessment of glucose uptake activity of Escherichia coli[J]. Biochim Biophys Acta, 1996, 1289(1): 5-9. pmid: 8605231
[11]	O'Neil RG, Wu L, Mullani N. Uptake of a fluorescent deoxyglucose analog(2-NBDG)in tumor cells[J]. Mol Imaging Biol, 2005, 7(6): 388-392. pmid: 16284704
[12]	Wieczorke R, Krampe S, Weierstall T, et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae[J]. FEBS Lett, 1999, 464(3): 123-128. doi: 10.1016/s0014-5793(99)01698-1 pmid: 10618490
[13]	Zhang LH, Zheng XM, Cairns TC, et al. Disruption or reduced expression of the orotidine-5'-decarboxylase gene pyrG increases citric acid production: a new discovery during recyclable genome editing in Aspergillus niger[J]. Microb Cell Fact, 2020, 19(1): 76. doi: 10.1186/s12934-020-01334-z
[14]	Lu YD, Zheng XM, Wang Y, et al. Evaluation of Aspergillus niger six constitutive strong promoters by fluorescent-auxotrophic selection coupled with flow cytometry: a case for citric acid production[J]. J Fungi, 2022, 8(6): 568. doi: 10.3390/jof8060568 URL
[15]	Basenko EY, Pulman JA, Shanmugasundram A, et al. FungiDB: an integrated bioinformatic resource for fungi and oomycetes[J]. J Fungi, 2018, 4(1): 39. doi: 10.3390/jof4010039 URL
[16]	Cairns TC, Zheng XM, Zheng P, et al. Moulding the mould: understanding and reprogramming filamentous fungal growth and morphogenesis for next generation cell factories[J]. Biotechnol Biofuels, 2019, 12: 77. doi: 10.1186/s13068-019-1400-4 pmid: 30988699
[17]	Yang YJ, Liu Y, Liu DD, et al. Development of a flow cytometry-based plating-free system for strain engineering in industrial fungi[J]. Appl Microbiol Biotechnol, 2022, 106(2): 713-727. doi: 10.1007/s00253-021-11733-w
[18]	Wang B, Li JG, Gao JF, et al. Identification and characterization of the glucose dual-affinity transport system in Neurospora crassa: pleiotropic roles in nutrient transport, signaling, and carbon catabolite repression[J]. Biotechnol Biofuels, 2017, 10: 17. doi: 10.1186/s13068-017-0705-4 URL