Genome Wide Identification and Expression Analysis of the bZIP Gene Family in Panax quinquefolius

doi:10.13560/j.cnki.biotech.bull.1985.2023-0970

Abstract

Abstract:

【Objective】The basic leucine zipper (bZIP) is one of the largest transcription factor families in plants, involved in multiple processes such as plant growth and hormone regulation. This study aims to identify the bZIP gene family in Panax quinquefolius and analyze its structure and expression patterns, providing a theoretical basis for further research on the function of the bZIP gene family in P. quinquefolius.【Method】Bioinformatics was used to analyze the physicochemical properties, phylogenetic relationships, gene structure, conserved motifs, cis acting elements, chromosomal localization, evolutionary selection pressure,and tissue-specific expression of the bZIP gene in P. quinquefolius. Simultaneously, exogenous hormone ABA was used to treat P. quinquefolius for transcriptome data analysis and RT-qPCR.【Result】A total of 121 bZIPs genes were identified in P. quinquefolius. According to the phylogenetic tree, these genes were divided into 12 subgroups. Gene structure and conserved motif analysis showed that proteins in the same subgroup had similar conserved motifs and domains, with conserved motif 1 being the most widely distributed and highly conserved in the bZIP protein of P. quinquefolius. The analysis of cis-acting elements showed that there were hormone responsive elements, defense and stress responsive elements in the upstream promoter element of bZIP, with ABA hormone responsive elements accounting for the largest proportion. Chromosome localization analysis showed that bZIP genes were unevenly distributed on 24 chromosomes. Conducting evolutionary selection pressure analysis, it was found that purification selection played an important role in the evolution of the bZIP gene family in P. quinquefolius; organizational specific expression analysis showed that the expression levels of PqbZIPs genes were relatively high in flowers and roots; transcriptome data revealed that bZIP transcription factors actively responded to ABA hormone treatment. Subsequently, RT-qPCR experiments were conducted to verify that the trend of gene expression changes was basically consistent. 【Conclusion】Members of the PqbZIP gene family have tissue-specific expression patterns and most respond to ABA hormone treatment.

Key words: bZIP, transcription factors, Panax quinquefolius, ABA, transcriptome

GUO Chun, SONG Gui-mei, YAN Yan, DI Peng, WANG Ying-ping. Genome Wide Identification and Expression Analysis of the bZIP Gene Family in Panax quinquefolius[J]. Biotechnology Bulletin, 2024, 40(4): 167-178.

Figures/Tables 11

References 39

[1]	Jakoby M, Weisshaar B, Dröge-Laser W, et al. bZIP transcription factors in Arabidopsis[J]. Trends Plant Sci, 2002, 7(3): 106-111. doi: 10.1016/s1360-1385(01)02223-3 pmid: 11906833
[2]	Pérez-Rodríguez P, Riaño-Pachón DM, Corrêa LGG, et al. PlnTFDB: updated content and new features of the plant transcription factor database[J]. Nucleic Acids Res, 2010, 38(Database issue): D822-D827.
[3]	Nijhawan A, Jain M, Tyagi AK, et al. Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice[J]. Plant Physiol, 2008, 146(2): 323-324.
[4]	Zhang Y, Gao WL, Li HT, et al. Genome-wide analysis of the bZIP gene family in Chinese jujube(Ziziphus jujuba Mill.)[J]. BMC Genom, 2020, 21(1): 483.
[5]	Fukazawa J, Sakai T, Ishida S, et al. Repression of shoot growth, a bZIP transcriptional activator, regulates cell elongation by controlling the level of gibberellins[J]. Plant Cell, 2000, 12(6): 901-915. doi: 10.1105/tpc.12.6.901 pmid: 10852936
[6]	Yin Y. RF2a, a bZIP transcriptional activator of the phloem-specific rice tungro bacilliform virus promoter, functions in vascular development[J]. EMBO J, 1997, 16(17): 5247-5259. pmid: 9311985
[7]	Baena-González E, Rolland F, Thevelein JM, et al. A central integrator of transcription networks in plant stress and energy signalling[J]. Nature, 2007, 448(7156): 938-942. doi: 10.1038/nature06069
[8]	Lara P, Oñate-Sánchez L, Abraham Z, et al. Synergistic activation of seed storage protein gene expression in Arabidopsis by ABI3 and two bZIPs related to OPAQUE2[J]. J Biol Chem, 2003, 278(23): 21003-21011. doi: 10.1074/jbc.M210538200 URL
[9]	Chinnusamy V, Ohta M, Kanrar S, et al. ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis[J]. Genes Dev, 2003, 17(8): 1043-1054. doi: 10.1101/gad.1077503 URL
[10]	Kiribuchi K, Sugimori M, Takeda M, et al. RERJ1, a jasmonic acid-responsive gene from rice, encodes a basic helix-loop-helix protein[J]. Biochem Biophys Res Commun, 2004, 325(3): 857-863. doi: 10.1016/j.bbrc.2004.10.126 URL
[11]	Liao Y, Zou HF, Wei W, et al. Soybean GmbZIP44, GmbZIP62 and GmbZIP78 genes function as negative regulator of ABA signaling and confer salt and freezing tolerance in transgenic Arabidopsis[J]. Planta, 2008, 228(2): 225-240. doi: 10.1007/s00425-008-0731-3 URL
[12]	Yang SQ, Xu K, Chen SJ, et al. A stress-responsive bZIP transcription factor OsbZIP62 improves drought and oxidative tolerance in rice[J]. BMC Plant Biol, 2019, 19(1): 260.
[13]	Ma HZ, Liu C, Li ZX, et al. ZmbZIP4 contributes to stress resistance in maize by regulating ABA synthesis and root development[J]. Plant Physiol, 2018, 178(2): 753-770. doi: 10.1104/pp.18.00436 pmid: 30126870
[14]	Tu MX, Wang XH, Feng TY, et al. Expression of a grape(Vitis vinifera)bZIP transcription factor, VlbZIP36, in Arabidopsis thaliana confers tolerance of drought stress during seed germination and seedling establishment[J]. Plant Sci, 2016, 252: 311-323. doi: 10.1016/j.plantsci.2016.08.011 URL
[15]	An JP, Yao JF, Wang XN, et al. MdHY5 positively regulates cold tolerance via CBF-dependent and CBF-independent pathways in apple[J]. J Plant Physiol, 2017, 218: 275-281. doi: 10.1016/j.jplph.2017.09.001 URL
[16]	Zhang Y, Xu ZC, Ji AJ, et al. Genomic survey of bZIP transcription factor genes related to tanshinone biosynthesis in Salvia miltiorrhiza[J]. Acta Pharm Sin B, 2018, 8(2): 295-305. doi: 10.1016/j.apsb.2017.09.002 pmid: 29719790
[17]	Liu JX, Srivastava R, Howell SH. Stress-induced expression of an activated form of AtbZIP17 provides protection from salt stress in Arabidopsis[J]. Plant Cell Environ, 2008, 31(12): 1735-1743. doi: 10.1111/pce.2008.31.issue-12 URL
[18]	Li DY, Fu FY, Zhang HJ, et al. Genome-wide systematic characterization of the bZIP transcriptional factor family in tomato(Solanum lycopersicum L.)[J]. BMC Genomics, 2015, 16: 771. doi: 10.1186/s12864-015-1990-6 URL
[19]	Wei KF, Chen J, Wang YM, et al. Genome-wide analysis of bZIP-encoding genes in maize[J]. DNA Res, 2012, 19(6): 463-476. doi: 10.1093/dnares/dss026 pmid: 23103471
[20]	Wang XL, Chen XL, Yang TB, et al. Genome-wide identification of bZIP family genes involved in drought and heat stresses in strawberry(Fragaria vesca)[J]. Int J Genomics, 2017, 2017: 3981031.
[21]	Wang JZ, Zhou JX, Zhang BL, et al. Genome-wide expansion and expression divergence of the basic leucine zipper transcription factors in higher plants with an emphasis on Sorghum[J]. J Integr Plant Biol, 2011, 53(3): 212-231. doi: 10.1111/j.1744-7909.2010.01017.x
[22]	Wang YP, Choi HK, Brinckmann JA, et al. Chemical analysis of Panax quinquefolius(North American ginseng): a review[J]. J Chromatogr A, 2015, 1426: 1-15. doi: 10.1016/j.chroma.2015.11.012 URL
[23]	Wang ZH, Wang XF, Lu TY, et al. Reshuffling of the ancestral core-eudicot genome shaped chromatin topology and epigenetic modification in Panax[J]. Nat Commun, 2022, 13(1): 1902.
[24]	Jin JP, Tian F, Yang DC, et al. PlantTFDB 4.0: toward a central hub for transcription factors and regulatory interactions in plants[J]. Nucleic Acids Res, 2017, 45(D1): D1040-D1045.
[25]	Wilkins MR, Gasteiger E, Bairoch A, et al. Protein identification and analysis tools in the ExPASy server[J]. Methods Mol Biol, 1999, 112: 531-552. pmid: 10027275
[26]	Kumar S, Stecher G, Li M, et al. MEGA X: molecular evolutionary genetics analysis across computing platforms[J]. Mol Biol Evol, 2018, 35(6): 1547-1549. doi: 10.1093/molbev/msy096 pmid: 29722887
[27]	Nguyen LT, Schmidt HA, von Haeseler A, et al. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies[J]. Mol Biol Evol, 2015, 32(1): 268-274. doi: 10.1093/molbev/msu300 URL
[28]	Subramanian B, Gao SH, Lercher MJ, et al. Evolview v3: a webserver for visualization, annotation, and management of phylogenetic trees[J]. Nucleic Acids Res, 2019, 47(W1): W270-W275.
[29]	Bailey TL, Williams N, Misleh C, et al. MEME: discovering and analyzing DNA and protein sequence motifs[J]. Nucleic Acids Res, 2006, 34(Web Server issue): W369-W373.
[30]	Chen CJ, Chen H, Zhang Y, et al. TBtools: an integrative toolkit developed for interactive analyses of big biological data[J]. Mol Plant, 2020, 13(8): 1194-1202. doi: S1674-2052(20)30187-8 pmid: 32585190
[31]	Lescot M, Déhais P, Thijs G, et al. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences[J]. Nucleic Acids Res, 2002, 30(1): 325-327. doi: 10.1093/nar/30.1.325 URL
[32]	Krzywinski M, Schein J, Birol İ, et al. Circos: an information aesthetic for comparative genomics[J]. Genome Res, 2009, 19(9): 1639-1645. doi: 10.1101/gr.092759.109 pmid: 19541911
[33]	Tang HB, Bowers JE, Wang XY, et al. Synteny and collinearity in plant genomes[J]. Science, 2008, 320(5875): 486-488. doi: 10.1126/science.1153917 pmid: 18436778
[34]	Zhang Z. KaKs_Calculator 3.0: calculating selective pressure on coding and non-coding sequences[J]. Genom Proteom Bioinform, 2022, 20(3): 536-540. doi: 10.1016/j.gpb.2021.12.002 URL
[35]	Zhang WW, Xu F, Cheng SY, et al. Characterization and functional analysis of a MYB gene(GbMYBFL)related to flavonoid accumulation in Ginkgo biloba[J]. Genes Genom, 2018, 40(1): 49-61. doi: 10.1007/s13258-017-0609-5
[36]	Liu X, Chu ZQ. Genome-wide evolutionary characterization and analysis of bZIP transcription factors and their expression profiles in response to multiple abiotic stresses in Brachypodium distachyon[J]. BMC Genom, 2015, 16(1): 227.
[37]	Ji CL, Mao X, Hao JY, et al. Analysis of bZIP transcription factor family and their expressions under salt stress in Chlamydomonas reinhardtii[J]. Int J Mol Sci, 2018, 19(9): 2800.
[38]	Gai WX, Ma X, Qiao YM, et al. Characterization of the bZIP transcription factor family in pepper(Capsicum annuum L.): CabZIP25 positively modulates the salt tolerance[J]. Front Plant Sci, 2020, 11: 139. doi: 10.3389/fpls.2020.00139 URL
[39]	Han YX, Hou ZN, He QL, et al. Genome-wide characterization and expression analysis of bZIP gene family under abiotic stress in Glycyrrhiza uralensis[J]. Front Genet, 2021, 12: 754237. doi: 10.3389/fgene.2021.754237 URL

基因 Gene	上游引物Forward primer（5'-3'）	下游引物Reverse primer（5'-3'）
PqbZIP1778	TGATACATCTTCTGTGTCACCAATTCC	TGCCTCCTCTCAACAACCTTCTC
PqbZIP3076	GCCAGAGCCAGCAACAAGTTC	GATCTCTTCATCACTCTCCATACCTTC
PqbZIP53695	GTGCCACAACTCAACCAGAAGG	TCCGACTCCATCCAAGGTGTTC
PqbZIP53753	TGATGAACGATAACGGCATTGATAGG	TCCAGTAGAATATCCGCCAAGAGG
GAPDH1-F	GCTATCAAGGAGGAGTCGGAGGG	CTGGACAGATGCCATGTGAACAA

基因 Gene	上游引物Forward primer（5'-3'）	下游引物Reverse primer（5'-3'）
PqbZIP1778	TGATACATCTTCTGTGTCACCAATTCC	TGCCTCCTCTCAACAACCTTCTC
PqbZIP3076	GCCAGAGCCAGCAACAAGTTC	GATCTCTTCATCACTCTCCATACCTTC
PqbZIP53695	GTGCCACAACTCAACCAGAAGG	TCCGACTCCATCCAAGGTGTTC
PqbZIP53753	TGATGAACGATAACGGCATTGATAGG	TCCAGTAGAATATCCGCCAAGAGG
GAPDH1-F	GCTATCAAGGAGGAGTCGGAGGG	CTGGACAGATGCCATGTGAACAA

Sequence	Method	Ka	Ks	Ka/Ks	Length/bp	Sequence	Method	Ka	Ks	Ka/Ks	Length/bp
bZIP2-bZIP43	MA	0.117946	0.165607	0.712204	960	bZIP67-bZIP1	MA	0.097071	0.323816	0.299772	1 152
bZIP3-bZIP44	MA	0.0130427	0.0128818	1.01249	489	bZIP70-bZIP19	MA	0.0142327	0.0409637	0.347448	1 332
bZIP10-bZIP38	MA	0.100549	0.140421	0.716056	846	bZIP73-bZIP14	MA	0.0547414	0.0672358	0.81417	702
bZIP10-bZIP112	MA	0.11451	0.521399	0.219622	879	bZIP76-bZIP36	MA	0.110057	0.324559	0.339097	564
bZIP11-bZIP37	MA	0.0942089	0.0981423	0.959922	957	bZIP79-bZIP104	MA	0.0904191	0.339624	0.266233	462
bZIP13-bZIP76	MA	0.104919	0.30191	0.347518	564	bZIP87-bZIP81	MA	0.317343	0.931453	0.340696	1 065
bZIP13-bZIP109	MA	0.101853	0.290082	0.351118	564	bZIP92-bZIP51	MA	0.015582	0.0313318	0.497324	903
bZIP15-bZIP54	MA	0.105643	0.321516	0.328579	972	bZIP98-bZIP52	MA	0.0483138	0.0459249	1.05202	1 023
bZIP15-bZIP55	MA	0.156553	0.426652	0.366934	1 197	bZIP100-bZIP80	MA	0.0367017	0.113648	0.322942	1 086
bZIP16-bZIP80	MA	0.0682639	0.322732	0.211519	1 128	bZIP101-bZIP83	MA	0.0497949	0.0973565	0.51147	1 368
bZIP16-bZIP100	MA	0.0627594	0.322994	0.194305	1 083	bZIP105-bZIP60	MA	0.0758902	0.29116	0.260647	1 218
bZIP36-bZIP109	MA	0.106955	0.312518	0.342235	564	bZIP108-bZIP53	MA	0.0113524	0.0549189	0.206712	1 002
bZIP45-bZIP20	MA	0.0126196	0.0519384	0.242973	435	bZIP114-bZIP26	MA	0.0106575	0.0442045	0.241095	846
bZIP46-bZIP24	MA	0.0182878	0.0429762	0.425534	1 533	bZIP115-bZIP81	MA	0.242357	0.752788	0.321946	1 068
bZIP47-bZIP23	MA	0.018861	0.0298436	0.631996	993	bZIP115-bZIP82	MA	0.16807	0.619685	0.271218	1 308
bZIP48-bZIP21	MA	0.0890243	0.194441	0.457848	663	bZIP118-bZIP85	MA	0.114442	0.317447	0.360506	894
bZIP50-bZIP95	MA	0.119225	0.411079	0.29003	843	bZIP118-bZIP103	MA	0.0895535	0.261122	0.342957	885
bZIP61-bZIP91	MA	0.168025	0.327658	0.512807	771	bZIP119-bZIP32	MA	0.0231439	0.0836963	0.276523	996

Sequence	Method	Ka	Ks	Ka/Ks	Length/bp	Sequence	Method	Ka	Ks	Ka/Ks	Length/bp
bZIP2-bZIP43	MA	0.117946	0.165607	0.712204	960	bZIP67-bZIP1	MA	0.097071	0.323816	0.299772	1 152
bZIP3-bZIP44	MA	0.0130427	0.0128818	1.01249	489	bZIP70-bZIP19	MA	0.0142327	0.0409637	0.347448	1 332
bZIP10-bZIP38	MA	0.100549	0.140421	0.716056	846	bZIP73-bZIP14	MA	0.0547414	0.0672358	0.81417	702
bZIP10-bZIP112	MA	0.11451	0.521399	0.219622	879	bZIP76-bZIP36	MA	0.110057	0.324559	0.339097	564
bZIP11-bZIP37	MA	0.0942089	0.0981423	0.959922	957	bZIP79-bZIP104	MA	0.0904191	0.339624	0.266233	462
bZIP13-bZIP76	MA	0.104919	0.30191	0.347518	564	bZIP87-bZIP81	MA	0.317343	0.931453	0.340696	1 065
bZIP13-bZIP109	MA	0.101853	0.290082	0.351118	564	bZIP92-bZIP51	MA	0.015582	0.0313318	0.497324	903
bZIP15-bZIP54	MA	0.105643	0.321516	0.328579	972	bZIP98-bZIP52	MA	0.0483138	0.0459249	1.05202	1 023
bZIP15-bZIP55	MA	0.156553	0.426652	0.366934	1 197	bZIP100-bZIP80	MA	0.0367017	0.113648	0.322942	1 086
bZIP16-bZIP80	MA	0.0682639	0.322732	0.211519	1 128	bZIP101-bZIP83	MA	0.0497949	0.0973565	0.51147	1 368
bZIP16-bZIP100	MA	0.0627594	0.322994	0.194305	1 083	bZIP105-bZIP60	MA	0.0758902	0.29116	0.260647	1 218
bZIP36-bZIP109	MA	0.106955	0.312518	0.342235	564	bZIP108-bZIP53	MA	0.0113524	0.0549189	0.206712	1 002
bZIP45-bZIP20	MA	0.0126196	0.0519384	0.242973	435	bZIP114-bZIP26	MA	0.0106575	0.0442045	0.241095	846
bZIP46-bZIP24	MA	0.0182878	0.0429762	0.425534	1 533	bZIP115-bZIP81	MA	0.242357	0.752788	0.321946	1 068
bZIP47-bZIP23	MA	0.018861	0.0298436	0.631996	993	bZIP115-bZIP82	MA	0.16807	0.619685	0.271218	1 308
bZIP48-bZIP21	MA	0.0890243	0.194441	0.457848	663	bZIP118-bZIP85	MA	0.114442	0.317447	0.360506	894
bZIP50-bZIP95	MA	0.119225	0.411079	0.29003	843	bZIP118-bZIP103	MA	0.0895535	0.261122	0.342957	885
bZIP61-bZIP91	MA	0.168025	0.327658	0.512807	771	bZIP119-bZIP32	MA	0.0231439	0.0836963	0.276523	996