Effects of Sequence Variation on the Biogenesis and Target Relationship of miR-378

doi:10.13560/j.cnki.biotech.bull.1985.2021-0137

Abstract

Abstract:

The aim of this study is to explore the effects of sequence variation on the structure,expression level and targets relationship of miR-378. PCR-sequencing was employed to align the sequence mutations of miR-378 in different pig breeds and to predict the changes of the secondary structure and free energy of miR-378 caused by the mutation. The miR-378 expression vectors was constructed to detect the effect of mutation on the expression level during the processing. TargetScan and TargetRank were used to analyze the change of target relationship caused by the mutation of miR-378. MicroRNA pull-down technique was adapted to verify the effect of mutation on the target relationship of miR-378. The results showed that there were two A>G mutations on the +49 and +68 position of pre-miR-378 in Rongchang and Neijiang pigs,and the secondary structure and free energy of pre-miR-378 were changed. And these two mutations affected the processing from pri-miR-378 to pre-miR-378,and enhanced the expressions of pre-miR-378 and mature miR-378. The mutation of +49/A>G changed the function and target relationship of miR-378,of which GDF6 and RAB10 were the target genes obtained and deleted after mutation,respectively,while the shared targets（Runx1t1 and Galnt3）were not affected by mutation. These results serve to highlight the importance of miRNA mutations and their impacts on miRNA biogenesis.

Key words: miR-378, sequence variation, biogenesis, targets

ZHANG Ting-huan, GUO Zong-yi, CHAI Jie, PAN Hong-mei, ZHANG Liang, CHEN Lei, LONG Xi. Effects of Sequence Variation on the Biogenesis and Target Relationship of miR-378[J]. Biotechnology Bulletin, 2022, 38(1): 205-214.

Figures/Tables 10

References 36

[1]	Gebert LFR, MacRae IJ. Regulation of microRNA function in animals[J]. Nat Rev Mol Cell Biol, 2019, 20(1):21-37. doi: 10.1038/s41580-018-0045-7 URL
[2]	Ameres SL, Zamore PD. Diversifying microRNA sequence and function[J]. Nat Rev Mol Cell Biol, 2013, 14(8):475-488.
[3]	Sheng P, Fields C, Aadland K, et al. Dicer cleaves 5'-extended microRNA precursors originating from RNA polymerase II transcription start sites[J]. Nucleic Acids Res, 2018, 46(11):5737-5752. doi: 10.1093/nar/gky306 URL
[4]	Gregory RI, Yan KP, Amuthan G, et al. The Microprocessor complex mediates the genesis of microRNAs[J]. Nature, 2004, 432(7014):235-240. doi: 10.1038/nature03120 URL
[5]	Lee Y, Ahn C, Han J, et al. The nuclear RNase III Drosha initiates microRNA processing[J]. Nature, 2003, 425(6956):415-419. doi: 10.1038/nature01957 URL
[6]	Fareh M, Yeom KH, Haagsma AC, et al. TRBP ensures efficient Dicer processing of precursor microRNA in RNA-crowded environments[J]. Nat Commun, 2016, 7:13694. doi: 10.1038/ncomms13694 URL
[7]	Koscianska E, Starega-Roslan J, Krzyzosiak WJ. The role of Dicer protein partners in the processing of microRNA precursors[J]. PLoS One, 2011, 6(12):e28548. doi: 10.1371/journal.pone.0028548 URL
[8]	Sun G, Yan J, Noltner K, et al. SNPs in human miRNA genes affect biogenesis and function[J]. RNA, 2009, 15(9):1640-1651. doi: 10.1261/rna.1560209 URL
[9]	Kotani A, Ha D, Schotte D, et al. A novel mutation in the miR-128b gene reduces miRNA processing and leads to glucocorticoid resistance of MLL-AF₄ acute lymphocytic leukemia cells[J]. Cell Cycle, 2010, 9(6):1037-1042. pmid: 20237425
[10]	Duan RH, Pak C, Jin P. Single nucleotide polymorphism associated with mature miR-125a alters the processing of pri-miRNA[J]. Hum Mol Genet, 2007, 16(9):1124-1131. doi: 10.1093/hmg/ddm062 URL
[11]	Harnprasopwat R, Ha D, Toyoshima T, et al. Alteration of processing induced by a single nucleotide polymorphism in pri-miR-126[J]. Biochem Biophys Res Commun, 2010, 399(2):117-122. doi: 10.1016/j.bbrc.2010.07.009 URL
[12]	Zhang Y, Yun Z, Gong L, et al. Comparison of miRNA evolution and function in plants and animals[J]. Microrna, 2018, 7(1):4-10. doi: 10.2174/2211536607666180126163031 pmid: 29372676
[13]	Mencía Á, Modamio-Høybjør S, Redshaw N, et al. Mutations in the seed region of human miR-96 are responsible for nonsyndromic progressive hearing loss[J]. Nat Genet, 2009, 41(5):609-613. doi: 10.1038/ng.355 URL
[14]	Xu LL, Shi CM, Xu GF, et al. TNF-α, IL-6, and leptin increase the expression of miR-378, an adipogenesis-related microRNA in human adipocytes[J]. Cell Biochem Biophys, 2014, 70(2):771-776. doi: 10.1007/s12013-014-9980-x URL
[15]	Gerin I, Bommer GT, McCoin CS, et al. Roles for miRNA-378/378* in adipocyte gene expression and lipogenesis[J]. Am J Physiol Endocrinol Metab, 2010, 299(2):E198-E206. doi: 10.1152/ajpendo.00179.2010 URL
[16]	Pan D, Mao C, Quattrochi B, et al. MicroRNA-378 controls classical brown fat expansion to counteract obesity[J]. Nat Commun, 2014, 5:4725. doi: 10.1038/ncomms5725 URL
[17]	Gagan J, Dey BK, Layer R, et al. MicroRNA-378 targets the myogenic repressor MyoR during myoblast differentiation[J]. J Biol Chem, 2011, 286(22):19431-19438. doi: 10.1074/jbc.M111.219006 URL
[18]	Hou X, Tang Z, Liu H, et al. Discovery of MicroRNAs associated with myogenesis by deep sequencing of serial developmental skeletal muscles in pigs[J]. PLoS One, 2012, 7(12):e52123. doi: 10.1371/journal.pone.0052123 URL
[19]	Knezevic I, Patel A, Sundaresan NR, et al. A novel cardiomyocyte-enriched microRNA, miR-378, targets insulin-like growth factor 1 receptor:implications in postnatal cardiac remodeling and cell survival[J]. J Biol Chem, 2012, 287(16):12913-12926. doi: 10.1074/jbc.M111.331751 pmid: 22367207
[20]	Liu W, Cao H, Ye C, et al. Hepatic miR-378 targets p110alpha and controls glucose and lipid homeostasis by modulating hepatic insulin signalling[J]. Nat Commun, 2014, 5:5684. doi: 10.1038/ncomms6684 URL
[21]	Xu S, Linher-Melville K, Yang BB, et al. Micro-RNA378(miR-378)regulates ovarian estradiol production by targeting aromatase[J]. Endocrinology, 2011, 152(10):3941-3951. doi: 10.1210/en.2011-1147 URL
[22]	Ma T, Jiang H, Gao Y, et al. Microarray analysis of differentially expressed microRNAs in non-regressed and regressed bovine corpus luteum tissue;microRNA-378 may suppress luteal cell apoptosis by targeting the interferon gamma receptor 1 gene[J]. J Appl Genet, 2011, 52(4):481-486. doi: 10.1007/s13353-011-0055-z URL
[23]	Chai J, Chen L, Luo Z, et al. Spontaneous single nucleotide polymorphism in porcine microRNA-378 seed region leads to functional alteration[J]. Biosci Biotechnol Biochem, 2018, 82(7):1081-1089. doi: 10.1080/09168451.2018.1459175 URL
[24]	Sun W, Lan J, Chen L, et al. A mutation in porcine pre-miR-15b alters the biogenesis of MiR-15b\16-1 cluster and strand selection of MiR-15b[J]. PLoS One, 2017, 12(5):e0178045. doi: 10.1371/journal.pone.0178045 URL
[25]	Li Y, Wang XQ, Zhang L, et al. A SNP in pri-miR-10a is associated with recurrent spontaneous abortion in a Han-Chinese population[J]. Oncotarget, 2016, 7(7):8208-8222. doi: 10.18632/oncotarget.v7i7 URL
[26]	Locke JM, Lango Allen H, Harries LW. A rare SNP in pre-miR-34a is associated with increased levels of miR-34a in pancreatic beta cells[J]. Acta Diabetol, 2014, 51(2):325-329. doi: 10.1007/s00592-013-0499-1 URL
[27]	Gong J, Tong Y, Zhang HM, et al. Genome-wide identification of SNPs in microRNA genes and the SNP effects on microRNA target binding and biogenesis[J]. Hum Mutat, 2012, 33(1):254-263. doi: 10.1002/humu.21641 URL
[28]	Hughes AE, Bradley DT, Campbell M, et al. Mutation altering the miR-184 seed region causes familial keratoconus with cataract[J]. Am J Hum Genet, 2011, 89(5):628-633. doi: 10.1016/j.ajhg.2011.09.014 pmid: 21996275
[29]	Dorn GW, Matkovich SJ, Eschenbacher WH, et al. A human 3' miR-499 mutation alters cardiac mRNA targeting and function[J]. Circ Res, 2012, 110(7):958-967. doi: 10.1161/CIRCRESAHA.111.260752 URL
[30]	Thielen N, van der Kraan P, van Caam A. TGFβ/BMP signaling pathway in cartilage homeostasis[J]. Cells, 2019, 8(9):969. doi: 10.3390/cells8090969 URL
[31]	Sartori R, Schirwis E, Blaauw B, et al. BMP signaling controls muscle mass[J]. Nat Genet, 2013, 45(11):1309-1318. doi: 10.1038/ng.2772 URL
[32]	Clendenning DE, Mortlock DP. The BMP ligand Gdf6 prevents differentiation of coronal suture mesenchyme in early cranial development[J]. PLoS One, 2012, 7(5):e36789. doi: 10.1371/journal.pone.0036789 URL
[33]	Logan CY, Nusse R. The Wnt signaling pathway in development and disease[J]. Annu Rev Cell Dev Biol, 2004, 20:781-810. doi: 10.1146/cellbio.2004.20.issue-1 URL
[34]	Ghosh N, Hossain U, Mandal A, et al. The Wnt signaling pathway:a potential therapeutic target against cancer[J]. Ann N Y Acad Sci, 2019, 1443(1):54-74. doi: 10.1111/nyas.2019.1443.issue-1 URL
[35]	O’Brien J, Hayder H, Zayed Y, et al. Overview of MicroRNA biogenesis, mechanisms of actions, and circulation[J]. Front Endocrinol:Lausanne, 2018, 9:402.
[36]	Cai Y, Yu X, Hu S, et al. A brief review on the mechanisms of miRNA regulation[J]. Genomics Proteomics Bioinformatics, 2009, 7(4):147-154. doi: 10.1016/S1672-0229(08)60044-3 URL

名称Name	序列Sequence	长度 Length/bp
pri-miR-378-F	CGGGATCCAAGGTATTTGGGGCACTGCA	23
pri-miR-378-R	GGGAAGCTTCAGGACAGTTCAGGCAAGGT	20

名称Name	序列Sequence	长度 Length/bp
pri-miR-378-F	CGGGATCCAAGGTATTTGGGGCACTGCA	23
pri-miR-378-R	GGGAAGCTTCAGGACAGTTCAGGCAAGGT	20

名称Name	序列Sequence	长度Length/bp
pri-miR-378-F	GAGGGAGGCAGCATGGTAAG	20
pre-miR-378-F	TGAAGGCAGGCAGAACCATT	20
precursor-miR-378-R	CGGGCCTTCTGACTCCAAG	19
miR-378/AA	ACTGGACTTGGAGTCAGAAGGC	22
miR-378/GG	ACTGGGCTTGGAGTCAGAAGGC	22

名称Name	序列Sequence	长度Length/bp
pri-miR-378-F	GAGGGAGGCAGCATGGTAAG	20
pre-miR-378-F	TGAAGGCAGGCAGAACCATT	20
precursor-miR-378-R	CGGGCCTTCTGACTCCAAG	19
miR-378/AA	ACTGGACTTGGAGTCAGAAGGC	22
miR-378/GG	ACTGGGCTTGGAGTCAGAAGGC	22

名称Name	序列Sequence	长度Length/bp
GDF6-F	CTCGAGCTACTAAATGACAG	20
GDF6-R	TCTCCTTCCTCACTGCCTGT	20
Runx1t1-F	ATCGGGAATTCCTTCACAGGC	21
Runx1t1-R	GCTTTTTGCAGCTCCGTCAT	20
Galnt3-F	ACGCAGGTGATTGCTCGTAA	20
Galnt3-R	AGGTCTGGCACATACGCTTC	20
RAB10-F	ATGTACTTGCTCAGCTCAACT	21
RAB10-R	AGGGACTCAAGCACATTATCCA	22