Effects of the Polymorphism of the Seed Sequence in Porcine miR-378 on Its Function and Carcass Traits

doi:10.13560/j.cnki.biotech.bull.1985.2020-1165

Abstract

Abstract:

The aim of this study is to explore the effects of miR-378 on its structure,function,and porcine carcass traits for the polymorphism of its seed sequence. The single nucleotide polymorphism(SNP)of Rongchang pig and Asian wild boar was used to analyze population genetic selection,to predict the changes of its structure by the polymorphism of miR-378 seed sequence,and to count the allele frequencies of miR-378 in different pig breeds. microRNA mimics were used to verify the function of miR-378 and related gene expressions in adipocytes for the polymorphism of its seed sequence. The association between the slaughter data of pig and the allele frequency of miR-378 were analyzed. The results showed that there was a strong selection signal at the miR-378 locus of Rongchang pig,and A> G mutation was found in the 5th position of miR-378-3p seed sequence. The allele frequency of this locus differed in different pig breeds,and the frequency of A allele in the pig breeds with the stronger artificial selection was higher. This mutation inhibited the function of miR-378 promoting lipid production in adipocytes,and eliminated the regulation of miR-378 on the adipocyte differentiation-related genes(PGC-1α and PGC-1 β)and the adipolysis-related genes(HSL,ATGL and CGI-58). Moreover,the genotype of this locus was significantly correlated with porcine carcass traits. Compared with the GG genotype,the thickness of backfat in AA and AG genotypes was significantly lower,and the eye-muscle area of AA genotype was significantly higher. The polymorphism of miR-378 seed sequence identified in this study could be used as a molecular marker for assisted selection of pig growth and carcass traits in pig breeding practice.

Key words: miR-378, seed sequence, polymorphism, lipogenesis, backfat thickness, eye-muscle area

ZHANG Ting-huan, ZHANG Li-juan, CHEN Si-qing, GUO Zong-yi. Effects of the Polymorphism of the Seed Sequence in Porcine miR-378 on Its Function and Carcass Traits[J]. Biotechnology Bulletin, 2021, 37(6): 154-162.

Figures/Tables 10

Table 1 RT-PCR primers

引物名称 Name	引物序列 Sequence	长度Length/bp
ap2-F	GGCGTGACTTCCACAAGAGTTTA	23
ap2-R	GCCTCTTCCTTTGGCTCATG	20
Ppar-γ-F	GTGAAGGATGCAAGGGTT	18
Ppar-γ-R	CCTGATGGCATTGTGAGA	18
C/EBP-α-R	TGGACAAGAACAGCAACGAG	20
C/EBP-α-F	TCACTGGTCAACTCCAGCAC	20
PGC-1α-F	AGCGCCGTGTGATTTACGTT	20
PGC-1α-R	CCGCAGATTTACGGTGCATT	20
PGC-1β-F	CAGACGTGAGAGCAGAGGGC	20
PGC-1β-R	CGAATGTATACCACACGGCCT	21
Resistin-F	CAACTCCCTGTTTCCAAATGC	21
Resistin-R	GTCCAGCAATTTAAGCCAATGTT	23
HSL-F	AACCAACCCTAGGCCAACTG	20
HSL-R	GCTGTGTGCACCAAACTACG	20
ATGL-F	AGGCCAATGTCTGCAGCACAT	21
ATGL-R	CAAGTTGTCTGAAATGCCGCC	21
CGI-58-F	CCCTCAGGTTGGACAAAATGA	21
CGI-58-R	AGGAAAACCCCATGGCTCTAC	21
GAPDH-F	ACCACAGTCCATGCCATCAC	20
GAPDH-R	TCCACCACCCTGTTGCTGTA	20
U6-F	CGCTTCGGCAGCACATATA	19
U6-R	TTCACGAATTTGCGTGTCAT	20
miR-378W	ACTGGACTTGGAGTCAGAAGGC	22
miR-378M	ACTGGGCTTGGAGTCAGAAGGC	22

Table 2 Amplification primer of miR-378

引物名称 Name	引物序列 Sequence	长度 Length/bp
miR-378-F	TAACCCCTAGGTGGGTCTGAG	21
miR-378-R	TCAGATGAGCAGGACAGTTCAG	22

Fig.1 Population genetic selection analysis of miR-378 locus in Rongchang pig and Asian wild boar The areas marked in yellow indicate the selected regions and the red five-pointed star indicates miR-378 locus

Fig.2 Secondary structure and free energy analysis of miR-378 wild type(miR-378W)and mutated type(miR-378 M) The red font indicates the mutation site

Fig.3 Allele frequency of the fifth base(A/G)of miR-378 seed sequence in different pig breeds Yellow represents A allele and red represents G allele

Fig.4 Effects of miR-378W and miR-378 M on the lipid production of adipocytes A:Transfection efficiency of miRNA mimics. B:Oil red O staining adipocytes,scale bar:50 μm. C:Quantitative analysis of the lipid content. **refers to significant difference(P < 0.01),the same below

Fig.5 Effects of miR-378W and miR-378 M on the expres-sion of lipid related genes A:The expression of genes related to adipogenesis. B:The expression of genes related to lipolysis. * refers to significant difference(P < 0.05),the same below

Fig.6 Base sequence alignment of miR-378 among 10 species The red letters represent the seed sequence of miR-378

Fig.7 Polymorphism of miR-378 seed sequence in Rong-chang pig cross population

Table 3 Number of individuals for three genotypes of miR-378 seed sequence in the population and their association with slaughter traits

	GG(24)	AG(51)	AA(32)	加性效应Additive effect	显性效应Dominant effect
最后肋骨处背膘厚 Backfat thickness at the last rib/cm	2.77^a±0.20	2.66^b±0.13	2.63^b±0.16	0.07	-0.04
眼肌面积 Eye-muscle area/cm²	22.16^b±1.08	23.25^ab±0.63	23.80^a±0.62	1.22	0.445
胴体瘦肉率 Lean percentage/%	48.12±1.06	48.28±0.64	48.32±0.55	0.32	0.07

References 36

[1]	Yapijakis C. Regulatory role of microRNAs in brain development and function[J]. Adv Exp Med Biol, 2020, 1195:237-247.
[2]	Ameres SL, Zamore PD. Diversifying microRNA sequence and function[J]. Nat Rev Mol Cell Biol, 2013, 14(8):475-488.
[3]	Michlewski G, Caceres JF. Post-transcriptional control of miRNA biogenesis[J]. RNA, 2019, 25(1):1-16. doi: 10.1261/rna.068692.118 pmid: 30333195
[4]	Hausser J, Zavolan M. Identification and consequences of miRNA-target interactions--beyond repression of gene expression[J]. Nat Rev Genet, 2014, 15(9):599-612.
[5]	Dorn GW 2nd, Matkovich SJ, Eschenbacher WH, et al. A human 3’ miR-499 mutation alters cardiac mRNA targeting and function[J]. Circ Res, 2012, 110(7):958-967. doi: 10.1161/CIRCRESAHA.111.260752 URL
[6]	Kotani A, Ha D, Schotte D, et al. A novel mutation in the miR-128b gene reduces miRNA processing and leads to glucocorticoid resistance of MLL-AF4 acute lymphocytic leukemia cells[J]. Cell Cycle, 2010, 9(6):1037-1042. pmid: 20237425
[7]	Sun W, Lan J, Chen L, et al. A mutation in porcine pre-miR-15b alters the biogenesis of MiR-15b\16-1 cluster and strand selection of MiR-15b[J]. PLoS One, 2017, 12(5):e0178045. doi: 10.1371/journal.pone.0178045 URL
[8]	Mencia A, Modamio-Hoybjor S, Redshaw N, et al. Mutations in the seed region of human miR-96 are responsible for nonsyndromic progressive hearing loss[J]. Nat Genet, 2009, 41(5):609-613. doi: 10.1038/ng.355 URL
[9]	Duan R, Pak C, Jin P. Single nucleotide polymorphism associated with mature miR-125a alters the processing of pri-miRNA[J]. Hum Mol Genet, 2007, 16(9):1124-1131. doi: 10.1093/hmg/ddm062 URL
[10]	Carrer M, Liu N, Grueter CE, et al. Control of mitochondrial metabolism and systemic energy homeostasis by microRNAs 378 and 378*[J]. Proc Natl Acad Sci USA, 2012, 109(38):15330-15335. doi: 10.1073/pnas.1207605109 URL
[11]	Gerin I, Bommer GT, Mccoin CS, et al. Roles for miRNA-378/378* in adipocyte gene expression and lipogenesis[J]. Am J Physiol Endocrinol Metab, 2010, 299(2):E198-206. doi: 10.1152/ajpendo.00179.2010 URL
[12]	Gagan J, Dey BK, Layer R, et al. MicroRNA-378 targets the myogenic repressor MyoR during myoblast differentiation[J]. J Biol Chem, 2011, 286(22):19431-19438. doi: 10.1074/jbc.M111.219006 URL
[13]	Tong H, Jiang R, Liu T, et al. bta-miR-378 promote the differentiation of bovine skeletal muscle-derived satellite cells[J]. Gene, 2018, 668:246-251. doi: 10.1016/j.gene.2018.03.102 URL
[14]	Hupkes M, Sotoca AM, Hendriks JM, et al. MicroRNA miR-378 promotes BMP2-induced osteogenic differentiation of mesenchymal progenitor cells[J]. BMC Mol Biol, 2014, 15:1. doi: 10.1186/1471-2199-15-1 URL
[15]	Chai J, Chen L, Luo Z, et al. Spontaneous single nucleotide polymorphism in porcine microRNA-378 seed region leads to functional alteration[J]. Bioscience, Biotechnology, and Biochemistry, 2018, 82(7):1081-1089. doi: 10.1080/09168451.2018.1459175 URL
[16]	Xu LL, Shi CM, Xu GF, et al. TNF-alpha, IL-6, and leptin increase the expression of miR-378, an adipogenesis-related microRNA in human adipocytes[J]. Cell Biochem Biophys, 2014, 70(2):771-776. doi: 10.1007/s12013-014-9980-x URL
[17]	Pan D, Mao C, Quattrochi B, et al. MicroRNA-378 controls classical brown fat expansion to counteract obesity[J]. Nat Commun, 2014, 5:4725. doi: 10.1038/ncomms5725 URL
[18]	Lu J, Webb R, Richardson JA, et al. MyoR:a muscle-restricted basic helix-loop-helix transcription factor that antagonizes the actions of MyoD[J]. Proc Natl Acad Sci USA, 1999, 96(2):552-557. doi: 10.1073/pnas.96.2.552 URL
[19]	Hou X, Tang Z, Liu H, et al. Discovery of MicroRNAs associated with myogenesis by deep sequencing of serial developmental skeletal muscles in pigs[J]. PLoS One, 2012, 7(12):e52123. doi: 10.1371/journal.pone.0052123 URL
[20]	Knezevic I, Patel A, Sundaresan NR, et al. A novel cardiomyocyte-enriched microRNA, miR-378, targets insulin-like growth factor 1 receptor:implications in postnatal cardiac remodeling and cell survival[J]. J Biol Chem, 2012, 287(16):12913-12926. doi: 10.1074/jbc.M111.331751 pmid: 22367207
[21]	Chai J, Chen L, Luo Z, et al. Spontaneous single nucleotide polymorphism in porcine microRNA-378 seed region leads to functional alteration[J]. Biosci Biotechnol Biochem, 2018, 82(7):1081-1089. doi: 10.1080/09168451.2018.1459175 URL
[22]	Wang K, Cao Y, Rong Y, et al. A novel SNP in EIF2AK4 gene is associated with thermal tolerance traits in Chinesecattle[J]. Animals(Basel), 2019, 9(6):375.
[23]	Chang JS, Ghosh S, Newman S, et al. A map of the PGC-1alpha- and NT-PGC-1alpha-regulated transcriptional network in brown adipose tissue[J]. Sci Rep, 2018, 8(1):7876. doi: 10.1038/s41598-018-26244-4 pmid: 29777200
[24]	Song W, Zhong C, Yuan Y, et al. Peroxisome proliferator-activated receptor-coactivator 1-beta(PGC-1beta)modulates the expression of genes involved in adipogenesis during preadipocyte differentiation in chicken[J]. Gene, 2020, 741:144516. doi: 10.1016/j.gene.2020.144516 URL
[25]	Xu L, Ma X, Verma NK, et al. Ablation of PPARgamma in subcutaneous fat exacerbates age-associated obesity and metabolic decline[J]. Aging Cell, 2018, 17(2):e12721. doi: 10.1111/acel.2018.17.issue-2 URL
[26]	Schreiber R, Xie H, Schweiger M. Of mice and men:The physiological role of adipose triglyceride lipase(ATGL)[J]. Biochim Biophys Acta Mol Cell Biol Lipids, 2019, 1864(6):880-899.
[27]	Demine S, Tejerina S, Bihin B, et al. Mild mitochondrial uncoupling induces HSL/ATGL-independent lipolysis relying on a form of autophagy in 3T3-L1 adipocytes[J]. J Cell Physiol, 2018, 233(2):1247-1265. doi: 10.1002/jcp.25994 URL
[28]	Korbelius M, Vujic N, Sachdev V, et al. ATGL/CGI-58-dependent hydrolysis of a lipid storage pool in murine enterocytes[J]. Cell Rep, 2019, 28(7):1923-1934.e4. doi: S2211-1247(19)30927-1 pmid: 31412256
[29]	Choy YH, Park BH, Choi TJ, et al. Estimation of relative economic weights of hanwoo carcass traits based on carcass market price[J]. Asian-Australas J Anim Sci, 2012, 25(12):1667-1673. doi: 10.5713/ajas.2012.12397 URL
[30]	Wei X, Shimizu T, Lai ZC. Mob as tumor suppressor is activated by Hippo kinase for growth inhibition in Drosophila[J]. EMBO J, 2007, 26(7):1772-1781. doi: 10.1038/sj.emboj.7601630 URL
[31]	Wang Z, Ma B, Ji X, et al. MicroRNA-378-5p suppresses cell proliferation and induces apoptosis in colorectal cancer cells by targeting BRAF[J]. Cancer Cell Int, 2015, 15:40. doi: 10.1186/s12935-015-0192-2 URL
[32]	Zeng M, Zhu L, Li L, et al. miR-378 suppresses the proliferation, migration and invasion of colon cancer cells by inhibiting SDAD1[J]. Cell Mol Biol Lett, 2017, 22:12. doi: 10.1186/s11658-017-0041-5 URL
[33]	Peng N, Miao Z, Wang L, et al. MiR-378 promotes the cell proliferation of osteosarcoma through down-regulating the expression of Kruppel-like factor 9[J]. Biochem Cell Biol, 2018, 96(5):515-521. doi: 10.1139/bcb-2017-0186 URL
[34]	Kuang X, Wei C, Zhang T, et al. miR-378 inhibits cell growth and enhances apoptosis in human myelodysplastic syndromes[J]. Int J Oncol, 2016, 49(5):1921-1930. doi: 10.3892/ijo.2016.3689 URL
[35]	Kulyte A, Lorente-Cebrian S, Gao H, et al. MicroRNA profiling links miR-378 to enhanced adipocyte lipolysis in human cancer cachexia[J]. Am J Physiol Endocrinol Metab, 2014, 306(3):E267-274. doi: 10.1152/ajpendo.00249.2013 URL
[36]	Li Y, Jiang J, Liu W, et al. microRNA-378 promotes autophagy and inhibits apoptosis in skeletal muscle[J]. Proc Natl Acad Sci USA, 2018, 115(46):E10849-E10858. doi: 10.1073/pnas.1803377115 URL