Biotechnology Bulletin ›› 2022, Vol. 38 ›› Issue (2): 75-82.doi: 10.13560/j.cnki.biotech.bull.1985.2021-0441
Previous Articles Next Articles
ZOU Liang-ping1(), GUO Xin1,2, QI Deng-feng1, ZHAI Min4, LI Zhuang4, ZHAO Ping-juan1, PENG Ming1(), NIU Xing-kui3()
Received:
2021-04-06
Online:
2022-02-26
Published:
2022-03-09
Contact:
PENG Ming,NIU Xing-kui
E-mail:zouliangping@itbb.org.cn;pengming@itbb.org.cn;nxk1981@sina.com
ZOU Liang-ping, GUO Xin, QI Deng-feng, ZHAI Min, LI Zhuang, ZHAO Ping-juan, PENG Ming, NIU Xing-kui. Anthocyanin Accumulation and Its Gene Expression Induced by Low Nitrogen Stress in Cassava Seedlings[J]. Biotechnology Bulletin, 2022, 38(2): 75-82.
基因名称Gene name | 基因号 Gene ID | 引物序列 Primer sequence |
---|---|---|
MePAL | Manes.04G018000 | CTCTCCTCCAGGGTTACTCCG |
GGCTATGTATGAAAAGGGGACTAAG | ||
Me4CL | Manes.09G127000 | GAGGATGCTCTACGGAGTAGGG |
AGCCAGTTTCAGGGTCAATGAC | ||
MeCHS | Manes.03G150000 | TCCGAGATAACAGCCGTGACAT |
GCAGAGACAAGTTCAAACAATGGC | ||
MeF3H | Manes.02G104700 | GATTGATGATGTTGGTGGGAAG |
AATCCCTTAGCAAGACGAGTCATC | ||
MeDFR | Manes.18G022300 | TCTGGCGTTTTCCATGTTGCTA |
CATCATACACTGGTTTTTTGTGTTCC | ||
MeANS | Manes.01G070200 | GGCAATGTTTTCGCAGAAGAGA |
CCATTCTTTAGCCGCACTTACAA |
Table 1 Specific primers for the genes related to anthocy-anin biosynthesis
基因名称Gene name | 基因号 Gene ID | 引物序列 Primer sequence |
---|---|---|
MePAL | Manes.04G018000 | CTCTCCTCCAGGGTTACTCCG |
GGCTATGTATGAAAAGGGGACTAAG | ||
Me4CL | Manes.09G127000 | GAGGATGCTCTACGGAGTAGGG |
AGCCAGTTTCAGGGTCAATGAC | ||
MeCHS | Manes.03G150000 | TCCGAGATAACAGCCGTGACAT |
GCAGAGACAAGTTCAAACAATGGC | ||
MeF3H | Manes.02G104700 | GATTGATGATGTTGGTGGGAAG |
AATCCCTTAGCAAGACGAGTCATC | ||
MeDFR | Manes.18G022300 | TCTGGCGTTTTCCATGTTGCTA |
CATCATACACTGGTTTTTTGTGTTCC | ||
MeANS | Manes.01G070200 | GGCAATGTTTTCGCAGAAGAGA |
CCATTCTTTAGCCGCACTTACAA |
Fig.1 Influences of the concentration and the forms of nitrogen onsterile cassava variety Arg7 seedling Data analysis was performed using ordinary one-way ANOVA test for multiple comparisons, i.e., extremely difference P<0.001 when other treatmets compared with 40 mmol/L NO3- +20 mmol/L NH4+
Fig.4 Anthocyanin content negatively correlated with the increase of nitrogen concentration A:1 mmol/L(N);B:5 mmol/L(N);C:9 mmol/L(N);D:13 mmol/L(N). A and B:bar=0.5 cm;C and D:bar=1 cm
[1] |
Allan AC, Hellens RP, Laing WA. MYB transcription factors that colour our fruit[J]. Trends Plant Sci, 2008, 13(3):99-102.
doi: 10.1016/j.tplants.2007.11.012 URL |
[2] |
Tian XZ, Xin HL, Paengkoum P, et al. Effects of anthocyanin-rich purple corn(Zea mays L.)stover silage on nutrient utilization, rumen fermentation, plasma antioxidant capacity, and mammary gland gene expression in dairy goats1[J]. J Animal Sci, 2019, 97(3):1384-1397.
doi: 10.1093/jas/sky477 URL |
[3] | Saigo T, Wang T, Watanabe M, et al. Diversity of anthocyanin and proanthocyanin biosynjournal in land plants[J]. CurrOpin Plant Biol, 2020, 55:93-99. |
[4] |
Rubin G, Tohge T, Matsuda F, et al. Members of the LBD family of transcription factors repress anthocyanin synjournal and affect additional nitrogen responses in Arabidopsis[J]. Plant Cell, 2009, 21(11):3567-3584.
doi: 10.1105/tpc.109.067041 URL |
[5] |
Zhou LL, Shi MZ, Xie DY. Regulation of anthocyanin biosynjournal by nitrogen in TTG1-GL3/TT8-PAP1-programmed red cells of Arabidopsis thaliana[J]. Planta, 2012, 236(3):825-837.
doi: 10.1007/s00425-012-1674-2 URL |
[6] |
Wang J, Wang Y, Yang J, et al. Arabidopsis ROOT HAIR DEFECTIVE3 is involved in nitrogen starvation-induced anthocyanin accumulation[J]. J Integr Plant Biol, 2015, 57(8):708-721.
doi: 10.1111/jipb.v57.8 URL |
[7] |
Yamuangmorn S, Dell B, Rerkasem B, et al. Applying nitrogen fertilizer increased anthocyanin in vegetative shoots but not in grain of purple rice genotypes[J]. J Sci Food Agric, 2018, 98(12):4527-4532.
doi: 10.1002/jsfa.2018.98.issue-12 URL |
[8] |
Lillo C, Lea US, Ruoff P. Nutrient depletion as a key factor for manipulating gene expression and product formation in different branches of the flavonoid pathway[J]. Plant Cell Environ, 2008, 31(5):587-601.
doi: 10.1111/j.1365-3040.2007.01748.x URL |
[9] |
Nemie-Feyissa D, Olafsdottir SM, Heidari B, et al. Nitrogen depletion and small R3-MYB transcription factors affecting anthocyanin accumulation in Arabidopsis leaves[J]. Phytochemistry, 2014, 98:34-40.
doi: 10.1016/j.phytochem.2013.12.006 pmid: 24388610 |
[10] |
Sun X, Jia X, Huo LQ, et al. MdATG18a overexpression improves tolerance to nitrogen deficiency and regulates anthocyanin accumulation through increased autophagy in transgenic apple[J]. Plant Cell Environ, 2018, 41(2):469-480.
doi: 10.1111/pce.v41.2 URL |
[11] |
Bao Do C, Cormier F. Effects of low nitrate and high sugar concentrations on anthocyanin content and composition of grape(Vitis vinifera L.)cell suspension[J]. Plant Cell Rep, 1991, 9(9):500-504.
doi: 10.1007/BF00232105 pmid: 24213789 |
[12] |
Becker C, Urlić B, JukićŠpika M, et al. Nitrogen limited red and green leaf lettuce accumulate flavonoid glycosides, caffeic acid derivatives, and sucrose while losing chlorophylls, Β-carotene and xanthophylls[J]. PLoS One, 2015, 10(11):e0142867.
doi: 10.1371/journal.pone.0142867 URL |
[13] |
Huang ZG, Liang MT, Peng JZ, et al. Exogenous ammonium inhibits petal pigmentation and expansion in Gerberahybrida[J]. Physiol Plant, 2008, 133(2):254-265.
doi: 10.1111/j.1399-3054.2008.01071.x URL |
[14] |
Ravazzolo L, Trevisan S, Forestan C, et al. Nitrate and ammonium affect the overall maize response to nitrogen availability by triggering specific and common transcriptional signatures in roots[J]. Int J Mol Sci, 2020, 21(2):686.
doi: 10.3390/ijms21020686 URL |
[15] |
Wang XF, An JP, Liu X, et al. The nitrate-responsive protein MdBT2 regulates anthocyanin biosynjournal by interacting with the MdMYB1 transcription factor[J]. Plant Physiol, 2018, 178(2):890-906.
doi: 10.1104/pp.18.00244 URL |
[16] |
Truong HA, Lee WJ, Jeong CY, et al. Enhanced anthocyanin accumulation confers increased growth performance in plants under low nitrate and high salt stress conditions owing to active modulation of nitrate metabolism[J]. J Plant Physiol, 2018, 231:41-48.
doi: 10.1016/j.jplph.2018.08.015 URL |
[17] |
Drunkler NL, Leite RS, Mandarino JMG, et al. Cassava starch as a stabilizer of soy-based beverages[J]. Food Sci Technol Int, 2012, 18(5):489-499.
doi: 10.1177/1082013211433072 pmid: 23144242 |
[18] |
Li P, Zhu MJ. A consolidated bio-processing of ethanol from cassava pulp accompanied by hydrogen production[J]. BioresourTechnol, 2011, 102(22):10471-10479.
doi: 10.1016/j.biortech.2011.08.134 URL |
[19] |
Siritunga D, Sayre R. Engineering cyanogen synjournal and turnover in cassava(Manihot esculenta)[J]. Plant Mol Biol, 2004, 56(4):661-669.
pmid: 15630626 |
[20] |
Tian QG, Konczak I, Schwartz SJ. Probing anthocyanin profiles in purple sweet potato cell line(IpomoeabatatasL. Cv. ayamurasaki)by high-performance liquid chromatography and electrospray ionization tandem mass spectrometry[J]. J Agric Food Chem, 2005, 53(16):6503-6509.
doi: 10.1021/jf050671m URL |
[21] |
Wang H, Yang J, Zhang M, et al. Altered phenylpropanoid metabolism in the maize lc-expressed sweet potato(Ipomoea batatas)affects storage root development[J]. Sci Rep, 2016, 6:18645.
doi: 10.1038/srep18645 URL |
[22] |
Kiba T, Inaba J, Kudo T, et al. Repression of nitrogen starvation responses by members of the Arabidopsis GARP-type transcription factor NIGT1/HRS1 subfamily[J]. Plant Cell, 2018, 30(4):925-945.
doi: 10.1105/tpc.17.00810 URL |
[23] | Bouguyon E, Perrine-Walker F, Pervent M, et al. Nitrate controls root development through posttranscriptional regulation of the NRT1. 1/NPF6. 3 transporter/sensor[J]. Plant Physiol, 2016, 172(2):1237-1248. |
[24] |
Wang W, Hu B, Yuan DY, et al. Expression of the nitrate transporter gene OsNRT1. 1A/OsNPF6. 3 confers high yield and early maturation in rice[J]. Plant Cell, 2018, 30(3):638-651.
doi: 10.1105/tpc.17.00809 URL |
[25] |
Lin-Wang K, Micheletti D, Palmer J, et al. High temperature reduces apple fruit colour via modulation of the anthocyanin regulatory complex[J]. Plant Cell Environ, 2011, 34(7):1176-1190.
doi: 10.1111/j.1365-3040.2011.02316.x URL |
[26] |
Xie XB, Li S, Zhang RF, et al. The bHLH transcription factor MdbHLH3 promotes anthocyanin accumulation and fruit colouration in response to low temperature in apples[J]. Plant Cell Environ, 2012, 35(11):1884-1897.
doi: 10.1111/j.1365-3040.2012.02523.x URL |
[27] | Fan XL, Xu ZB, Wang F, et al. Identification of colored wheat genotypes with suitable quality and yield traits in response to low nitrogen input[J]. PLoS One, 2020, 15(4):e0229535. |
[28] |
Rowan DD, Cao M, Lin-Wang K, et al. Environmental regulation of leaf colour in red 35S:PAP1 Arabidopsis thaliana[J]. New Phytol, 2009, 182(1):102-115.
doi: 10.1111/nph.2009.182.issue-1 URL |
[29] |
Scheible WR, Morcuende R, Czechowski T, et al. Genome-wide reprogramming of primary and secondary metabolism, protein synjournal, cellular growth processes, and the regulatory infrastructure of Arabidopsis in response to nitrogen[J]. Plant Physiol, 2004, 136(1):2483-2499.
doi: 10.1104/pp.104.047019 URL |
[1] | YANG Zhi-xiao, HOU Qian, LIU Guo-quan, LU Zhi-gang, CAO Yi, GOU Jian-yu, WANG Yi, LIN Ying-chao. Responses of Rubisco and Rubisco Activase in Different Resistant Tobacco Strains to Brown Spot Stress [J]. Biotechnology Bulletin, 2023, 39(9): 202-212. |
[2] | CHEN Zhong-yuan, WANG Yu-hong, DAI Wei-jun, ZHANG Yan-min, YE Qian, LIU Xu-ping, TAN Wen-Song, ZHAO Liang. Mechanism Investigation of Ferric Ammonium Citrate on Transfection for Suspended HEK293 Cells [J]. Biotechnology Bulletin, 2023, 39(9): 311-318. |
[3] | XIAO Liang, WU Zheng-dan, LU Liu-ying, SHI Ping-li, SHANG Xiao-hong, CAO Sheng, ZENG Wen-dan, YAN Hua-bing. Research Progress of Important Traits Genes in Cassava [J]. Biotechnology Bulletin, 2023, 39(6): 31-48. |
[4] | LI Zhi-qi, YUAN Yue, MIAO Rong-qing, PANG Qiu-ying, ZHANG Ai-qin. Melatonin Contents in Eutrema salsugineum and Arabidopsis thaliana Under Salt Stress, and Expression Pattern Analysis of Synthesis Related Genes [J]. Biotechnology Bulletin, 2023, 39(5): 142-151. |
[5] | LIU Kui, LI Xing-fen, YANG Pei-xin, ZHONG Zhao-chen, CAO Yi-bo, ZHANG Ling-yun. Functional Study and Validation of Transcriptional Coactivator PwMBF1c in Picea wilsonii [J]. Biotechnology Bulletin, 2023, 39(5): 205-216. |
[6] | LAI Rui-lian, FENG Xin, GAO Min-xia, LU Yu-dan, LIU Xiao-chi, WU Ru-jian, CHEN Yi-ting. Genome-wide Identification of Catalase Family Genes and Expression Analysis in Kiwifruit [J]. Biotechnology Bulletin, 2023, 39(4): 136-147. |
[7] | GUO San-bao, SONG Mei-ling, LI Ling-xin, YAO Zi-zhao, GUI Ming-ming, HUANG Sheng-he. Cloning and Analysis of Chalcone Synthase Gene and Its Promoter from Euphorbia maculata [J]. Biotechnology Bulletin, 2023, 39(4): 148-156. |
[8] | CHEN Qiang, ZHOU Ming-kang, SONG Jia-min, ZHANG Chong, WU Long-kun. Identification and Analysis of LBD Gene Family and Expression Analysis of Fruit Development in Cucumis melo [J]. Biotechnology Bulletin, 2023, 39(3): 176-183. |
[9] | PING Huai-lei, GUO Xue, YU Xiao, SONG Jing, DU Chun, WANG Juan, ZHANG Huai-bi. Cloning and Expression of PdANS in Paeonia delavayi and Correlation with Anthocyanin Content [J]. Biotechnology Bulletin, 2023, 39(3): 206-217. |
[10] | YAO Xiao-wen, LIANG Xiao, CHEN Qing, WU Chun-ling, LIU Ying, LIU Xiao-qiang, SHUI Jun, QIAO Yang, MAO Yi-ming, CHEN Yin-hua, ZHANG Yin-dong. Study on the Expression Pattern of Genes in Lignin Biosynthesis Pathway of Cassava Resisting to Tetranychus urticae [J]. Biotechnology Bulletin, 2023, 39(2): 161-171. |
[11] | LI Yan-xia, WANG Jin-peng, FENG Fen, BAO Bin-wu, DONG Yi-wen, WANG Xing-ping, LUORENG Zhuo-ma. Effects of Escherichia coli Dairy Cow Mastitis on the Expressions of Milk-producing Trait Related Genes [J]. Biotechnology Bulletin, 2023, 39(2): 274-282. |
[12] | FENG Ce-ting, JIANG Lyu, LIU Xing-ying, LUO Le, PAN Hui-tang, ZHANG Qi-xiang, YU Chao. Identification of the NAC Gene Family in Rosa persica and Response Analysis Under Drought Stress [J]. Biotechnology Bulletin, 2023, 39(11): 283-296. |
[13] | JIANG Nan, SHI Yang, ZHAO Zhi-hui, LI Bin, ZHAO Yi-hui, YANG Jun-biao, YAN Jia-ming, JIN Yu-fan, CHEN Ji, HUANG Jin. Expression and Functional Analysis of OsPT1 Gene in Rice Under Cadmium Stress [J]. Biotechnology Bulletin, 2023, 39(1): 166-174. |
[14] | DUAN Min-jie, LI Yi-fei, YANG Xiao-miao, WANG Chun-ping, HUANG Qi-zhong, HUANG Ren-zhong, ZHANG Shi-cai. Identification of Zinc Finger Protein DnaJ-Like Gene Family in Capsicum annuum and Its Expression Analysis Responses to High Temperature Stress [J]. Biotechnology Bulletin, 2023, 39(1): 187-198. |
[15] | YU Xiao-ling, LI Wen-bin, LI Zhi-bo, RUAN Meng-bin. Cold Resistance Function Analysis of Cassava MeMYC2.2 [J]. Biotechnology Bulletin, 2023, 39(1): 224-231. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||