Functional Study of Vitamin B1 Synthesis-related Gene OsTHIC in Rice

doi:10.13560/j.cnki.biotech.bull.1985.2023-0797

Abstract

Abstract:

【Objective】 Vitamin B₁ (VB₁) is a biologically essential micronutrient that acts as a cofactor for several enzymes and is involved in important cellular metabolic pathways. However, the synthesis pathway of vitamin B₁ in rice remains elusive. The aim of this study is to elucidate the biological functions of OsTHIC, a gene related to vitamin B₁ synthesis in rice.【Method】 We used a combination of mutagenesis techniques, pigment measurement, Mutmap+, gene editing, and non-targeted metabolomics analysis to clone the target gene and analyze its biological functions.【Result】 An albino lethal mutant, wll1 (white leaf and lethal 1), was obtained from EMS-induced mutant pool of japonica rice variety Nipponbare. The fourth leaf of wll1 had albino phenotype and the albino phenotype spread to other leaves, ultimately leading to seedling death. The photosynthetic chlorophyll and carotenoid contents of the wll1 mutant was significantly lower than that of the wild type (WT). The target gene OsTHIC involved in VB₁ synthesis was determined by MutMap+ and gene editing technology. OsTHIC gene was expressed in various tissues of rice, with the highest expression in the leaves and OsTHIC protein was localized in chloroplasts. The VB₁ content in the wll1 was significantly lower than that of the WT. Exogenous VB₁ restored the mutated phenotype of wll1. Exogenous VB₁ and OsTHIC mutation both affected the expressions of genes related to VB₁ synthesis. Non-targeted metabolome sequencing analysis showed that differential metabolites between wild type and wll1 were significantly enriched in amino acid biosynthesis, cofactor biosynthesis, ABC transporters, and aminoacyl-tRNA biosynthesis pathways.【Conclusion】 OsTHIC plays an important role in the growth and development of rice by regulating the content of VB₁ and participating in metabolic processes such as amino acid synthesis.

Key words: OsTHIC, vitamin B₁, leaf color, Mutmap+, rice

ZHANG Chao, WANG Zi-rui, SUN Ya-li, MAO Xin-chen, TANG Jia-qi, YU Heng-xiu. Functional Study of Vitamin B₁ Synthesis-related Gene OsTHIC in Rice[J]. Biotechnology Bulletin, 2024, 40(2): 99-108.

Figures/Tables 8

Table 1 Sequences of primers used in RT-qPCR

Primer name	Forward primer sequence（5'-3'）	Reverse primer sequence（5'-3'）
OsTHIC-RT	AAGATGTGCAGGACAGGAGC	ACATGGCCAGATTCCTCGTG
OsTH1-RT	CGCCGTCGAGGACCTCAT	GACTGCGTGTCGTGGTTCATC
OsTHI1-RT	TACGACGAGCAGGAGGACTAC	CGTTGAACAGCTTCACGTTGG
OsPALE1-RT	GCCAATACATCGCCCAGG	CGACGATGGTGGCCTTGT
TPK1-RT	AGGTCCGCATGAGGTACAAG	TCAACTATTTCGGCACCCAG
TPK2-RT	GCCCCGCCTGTGGACTCA	CGGGTGCTTTCATAGTCTGGA
TPK3-RT	TCAGGACACCACCGATTTAC	CATCTCGTGGTCAAACCTTC
Ubiquitin	CAAGATGATCTGCCGCAAATGC	TTAACCAGTCCATGAACCCG

Fig. 1 Phenotypic characterization and photosynthesis pigment measurement of wll1 A: Phenotypes of of the seedlings at one-, two-, and three-leaf stage of wild type and wll1. Bar=1 cm. B: Phenotypes of the seedlings at four-leaf stage of wild type and wll1. Arrows indicate white leaves. Bar=1 cm. C: Photosynthesis pigment content of the third leaves of wild type and wll1 at four-leaf stage. D: Photosynthesis pigment measurement of the fourth leaves of wild type and wll1 at four-leaf stage. n.s. indicates no significant differencest. Asterisks indicate significant differences（**P <0.01）， the same below

Table 2 Candidate mutation sites in wll1

Position	Mutation type	Index^WT	Index^Mutant	Annotation
Chr3-24858822	G to A	0.29	1	LOC_Os03g44240 Intron
Chr3-25176848	G to A	0.41	1	Intergenic region
Chr3-26049430	G to A	0.11	1	Intergenic region
Chr3-26101874	G to A	0.15	1	Intergenic region
Chr3-26268328	G to A	0.37	1	Intergenic region
Chr3-26295456	G to A	0.39	1	LOC_Os03g46480 Intron
Chr3-26372631	G to A	0.36	1	LOC_Os03g46590 Exon
Chr3-26862420	T to C	0.22	1	Intergenic region
Chr3-26955051	G to A	0.25	1	LOC_Os03g47610 Exon
Chr3-27059507	G to A	0.36	1	LOC_Os03g47740 Exon
Chr3-27128816	G to A	0.32	1	LOC_Os03g47790 Intron
Chr3-27371505	G to A	0.35	1	Intergenic region
Chr3-27377064	G to A	0.31	1	LOC_Os03g48140 Exon
Chr3-27379000	G to A	0.29	1	LOC_Os03g48140 Intron
Chr3-27418905	G to A	0.35	1	LOC_Os03g48180 Promoter

Fig. 2 wll1-like phenotype by knocking out OsTHIC A： Gene structure of OsTHIC. The triangle indicates the position of mutation in wll1. Nucleotide and amino acid modification in wll1 are listed below. The position of target sequence for gene editing is marked with arrow. Blue line indicates the position of riboswitch. B: Target sequence for CRISPR/Cas9 gene editing and genotype of knock-out mutants of OsTHIC（OsTHIC-Cr）. Inserted nucleotide is shown in red. C：Phenotype of OsTHIC-Cr. Bar=5 cm

Fig. 3 Expression pattern of OsTHIC and subcellular localization of OsTHIC A: Relative expressions of OsTHIC in different tissues. Seed 1: Seeds 2 DAF（days after pollination）. Seed 2: Seeds 7 DAF. Seed 3: Seeds 25 DAF. Different letters indicate significant difference. B: Subcellular localization of OsTHIC in rice protoplasts. Chloroplast auto-fluorescence is in red

Fig. 4 Vitamin B1 content and phenotype after exogenous vitamin B1 treatment of OsTHIC mutant A: Vitamin B1 content in the fourth leaf of wild type, wll1, and OsTHIC-Cr. B: Phenotype of wll1 plant sprayed with exogenous vitamin B1. Bar=5 cm

Fig. 5 Influences on expressions of vitamin B1 biosynthesis genes by mutation of OsTHIC and exogenous vitamin B1 treatment A: Comparison of expression level of vitamin B1 biosynthesis genes between wild type and wll1. B: Comparison of expression level of vitamin B1 biosynthesis genes between plants treated with vitamin B1 and control plants

Fig. 6 Analysis of untargeted metabolomics of wild type and wll1 A: PCA of metabolite between wild type and wll1. B: Volcano map of differential metabolite between wild type and wll1. C: Enrichment analysis of differential metabolite KEGG pathway

References 37

[1]	Sambon M, Wins P, Bettendorff L. Neuroprotective effects of thiamine and precursors with higher bioavailability: focus on benfotiamine and dibenzoylthiamine[J]. Int J Mol Sci, 2021, 22(11): 5418. doi: 10.3390/ijms22115418 URL
[2]	Fardet A. New hypotheses for the health-protective mechanisms of whole-grain cereals: what is beyond fibre?[J]. Nutr Res Rev, 2010, 23(1): 65-134. doi: 10.1017/S0954422410000041 pmid: 20565994
[3]	Huang HM, Chen HL, Gibson GE. Thiamine and oxidants interact to modify cellular calcium stores[J]. Neurochem Res, 2010, 35(12): 2107-2116. doi: 10.1007/s11064-010-0242-z URL
[4]	Nosaka K. Recent progress in understanding thiamin biosynthesis and its genetic regulation in Saccharomyces cerevisiae[J]. Appl Microbiol Biotechnol, 2006, 72(1): 30-40. doi: 10.1007/s00253-006-0464-9 URL
[5]	Whitfield KC, Smith TJ, Rohner F, et al. Thiamine fortification strategies in low- and middle-income settings: a review[J]. Ann N Y Acad Sci, 2021, 1498(1): 29-45. doi: 10.1111/nyas.v1498.1 URL
[6]	Lonsdale D. A review of the biochemistry, metabolism and clinical benefits of thiamin(e)and its derivatives[J]. Evid Based Complement Alternat Med, 2006, 3(1): 49-59. doi: 10.1093/ecam/nek009 URL
[7]	Dong W, Stockwell VO, Goyer A. Enhancement of thiamin content in Arabidopsis thaliana by metabolic engineering[J]. Plant Cell Physiol, 2015, 56(12): 2285-2296. doi: 10.1093/pcp/pcv148 pmid: 26454882
[8]	Goyer A. Thiamine in plants: aspects of its metabolism and functions[J]. Phytochemistry, 2010, 71: 1615-1624. doi: 10.1016/j.phytochem.2010.06.022 pmid: 20655074
[9]	Woodward JB, Abeydeera ND, Paul D, et al. A maize thiamine auxotroph is defective in shoot meristem maintenance[J]. Plant Cell, 2010, 22(10): 3305-3317. doi: 10.1105/tpc.110.077776 URL
[10]	Boubakri H, Gargouri M, Mliki A, et al. Vitamins for enhancing plant resistance[J]. Planta, 2016, 244(3): 529-543. doi: 10.1007/s00425-016-2552-0 pmid: 27315123
[11]	Ahn IP, Kim S, Lee YH, et al. Vitamin B₁-induced priming is dependent on hydrogen peroxide and the NPR1 gene in Arabidopsis[J]. Plant Physiol, 2007, 143(2): 838-848. doi: 10.1104/pp.106.092627 URL
[12]	Ahn IP, Kim S, Lee YH. Vitamin B₁ functions as an activator of plant disease resistance[J]. Plant Physiol, 2005, 138(3): 1505-1515. doi: 10.1104/pp.104.058693 URL
[13]	Rapala-Kozik M, Kowalska E, Ostrowska K. Modulation of thiamine metabolism in Zea mays seedlings under conditions of abiotic stress[J]. J Exp Bot, 2008, 59(15): 4133-4143. doi: 10.1093/jxb/ern253 pmid: 18940932
[14]	Tunc-Ozdemir M, Miller G, Song LH, et al. Thiamin confers enhanced tolerance to oxidative stress in Arabidopsis[J]. Plant Physiol, 2009, 151(1): 421-432. doi: 10.1104/pp.109.140046 pmid: 19641031
[15]	Rapala-Kozik M, Wolak N, Kujda M, et al. The upregulation of thiamine(vitamin B₁)biosynthesis in Arabidopsis thaliana seedlings under salt and osmotic stress conditions is mediated by abscisic acid at the early stages of this stress response[J]. BMC Plant Biol, 2012, 12: 2. doi: 10.1186/1471-2229-12-2 pmid: 22214485
[16]	Sayed SA, Gadallah MAA. Effects of shoot and root application of thiamin on salt-stressed sunflower plants[J]. Plant Growth Regul, 2002, 36(1): 71-80. doi: 10.1023/A:1014784831387 URL
[17]	Guan JC, Hasnain G, Garrett TJ, et al. Divisions of labor in the thiamin biosynthetic pathway among organs of maize[J]. Front Plant Sci, 2014, 5: 370. doi: 10.3389/fpls.2014.00370 URL
[18]	Mimura M, Zallot R, Niehaus TD, et al. Arabidopsis TH2 encodes the orphan enzyme thiamin monophosphate phosphatase[J]. Plant Cell, 2016, 28(10): 2683-2696. doi: 10.1105/tpc.16.00600 URL
[19]	Jurgenson CT, Begley TP, Ealick SE. The structural and biochemical foundations of thiamin biosynthesis[J]. Annu Rev Biochem, 2009, 78: 569-603. doi: 10.1146/annurev.biochem.78.072407.102340 pmid: 19348578
[20]	Hsieh WY, Liao JC, Wang HT, et al. The Arabidopsis thiamin-deficient mutant pale green1 lacks thiamin monophosphate phosphatase of the vitamin B₁ biosynthesis pathway[J]. Plant J, 2017, 91(1): 145-157. doi: 10.1111/tpj.2017.91.issue-1 URL
[21]	Ajjawi I, Rodriguez Milla MA, Cushman J, et al. Thiamin pyrophosphokinase is required for thiamin cofactor activation in Arabidopsis[J]. Plant Mol Biol, 2007, 65(1-2): 151-162. pmid: 17611796
[22]	Martinis J, Gas-Pascual E, Szydlowski N, et al. Long-distance transport of thiamine(vitamin B₁)is concomitant with that of polyamines[J]. Plant Physiol, 2016, 171(1): 542-553. doi: 10.1104/pp.16.00009 pmid: 27006489
[23]	Raschke M, Bürkle L, Müller N, et al. Vitamin B₁ biosynthesis in plants requires the essential iron sulfur cluster protein, THIC[J]. Proc Natl Acad Sci USA, 2007, 104(49): 19637-19642. doi: 10.1073/pnas.0709597104 pmid: 18048325
[24]	Kong DY, Zhu YX, Wu HL, et al. AtTHIC, a gene involved in thiamine biosynthesis in Arabidopsis thaliana[J]. Cell Res, 2008, 18(5): 566-576. doi: 10.1038/cr.2008.35
[25]	Kong WY, Yu XW, Chen HY, et al. The catalytic subunit of magnesium-protoporphyrin IX monomethyl ester cyclase forms a chloroplast complex to regulate chlorophyll biosynthesis in rice[J]. Plant Mol Biol, 2016, 92(1-2): 177-191. doi: 10.1007/s11103-016-0513-4 pmid: 27514852
[26]	Fekih R, Takagi H, Tamiru M, et al. MutMap+: genetic mapping and mutant identification without crossing in rice[J]. PLoS One, 2013, 8(7): e68529. doi: 10.1371/journal.pone.0068529 URL
[27]	Lai ZJ, Tsugawa H, Wohlgemuth G, et al. Identifying metabolites by integrating metabolome databases with mass spectrometry cheminformatics[J]. Nat Methods, 2018, 15(1): 53-56. doi: 10.1038/nmeth.4512 pmid: 29176591
[28]	Strobbe S, Verstraete J, Stove C, et al. Metabolic engineering of rice endosperm towards higher vitamin B₁ accumulation[J]. Plant Biotechnol J, 2021, 19(6): 1253-1267. doi: 10.1111/pbi.13545 pmid: 33448624
[29]	Dong W, Thomas N, Ronald PC, et al. Overexpression of thiamin biosynthesis genes in rice increases leaf and unpolished grain thiamin content but not resistance to Xanthomonas oryzae pv. oryzae[J]. Front Plant Sci, 2016, 7: 616. doi: 10.3389/fpls.2016.00616 pmid: 27242822
[30]	Strobbe S, Van Der Straeten D. Toward eradication of B-vitamin deficiencies: considerations for crop biofortification[J]. Front Plant Sci, 2018, 9: 443. doi: 10.3389/fpls.2018.00443 pmid: 29681913
[31]	Win AZ. Micronutrient deficiencies in early childhood can lower a country's GDP: the Myanmar example[J]. Nutrition, 2016, 32(1): 138-140. doi: 10.1016/j.nut.2015.06.011 pmid: 26421387
[32]	Nie YS, Yu L, Mao LL, et al. Vitamin B₁ THIAMIN REQUIRING1 synthase mediates the maintenance of chloroplast function by regulating sugar and fatty acid metabolism in rice[J]. J Integr Plant Biol, 2022, 64(8): 1575-1595. doi: 10.1111/jipb.v64.8 URL
[33]	Bocobza SE, Malitsky S, Araújo WL, et al. Orchestration of thiamin biosynthesis and central metabolism by combined action of the thiamin pyrophosphate riboswitch and the circadian clock in Arabidopsis[J]. Plant Cell, 2013, 25(1): 288-307. doi: 10.1105/tpc.112.106385 URL
[34]	Winkler W, Nahvi A, Breaker RR. Thiamine derivatives bind messenger RNAs directly to regulate bacterial gene expression[J]. Nature, 2002, 419(6910): 952-956. doi: 10.1038/nature01145 URL
[35]	Mironov AS, Gusarov I, Rafikov R, et al. Sensing small molecules by nascent RNA: a mechanism to control transcription in bacteria[J]. Cell, 2002, 111(5): 747-756. pmid: 12464185
[36]	Sudarsan N, Barrick JE, Breaker RR. Metabolite-binding RNA domains are present in the genes of eukaryotes[J]. RNA, 2003, 9(6): 644-647. pmid: 12756322
[37]	Thore S, Leibundgut M, Ban N. Structure of the eukaryotic thiamine pyrophosphate riboswitch with its regulatory ligand[J]. Science, 2006, 312(5777): 1208-1211. pmid: 16675665

Functional Study of Vitamin B₁ Synthesis-related Gene OsTHIC in Rice

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 8

References 37

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	LI Xue, LI Rong-ou, KONG Mei-yi, HUANG Lei. The Growth Promoting Effect of Bacillus amyloliquefaciens SQ-2 on Rice [J]. Biotechnology Bulletin, 2024, 40(2): 109-119.
[2]	LIN Xin-yan, ZHANG Chuan-zhong, DAI Bing, WANG Xin-heng, LIU Jian-feng, WEN Li, XU Xing-jian, FANG Jun. Advances in Genetic and Molecular Mechanisms of Pre-harvest Sprouting in Rice [J]. Biotechnology Bulletin, 2024, 40(1): 24-31.
[3]	WANG Zi-ying, LONG Chen-jie, FAN Zhao-yu, ZHANG Lei. Screening of OsCRK5-interacted Proteins in Rice Using Yeast Two-hybrid System [J]. Biotechnology Bulletin, 2023, 39(9): 117-125.
[4]	ZHAN Yan, ZHOU Li-bin, JIN Wen-jie, DU Yan, YU Li-xia, QU Ying, MA Yong-gui, LIU Rui-yuan. Research Progress in Plant Leaf Color Mutation Induced by Radiation [J]. Biotechnology Bulletin, 2023, 39(8): 106-113.
[5]	WU Yuan-ming, LIN Jia-yi, LIU Yu-xi, LI Dan-ting, ZHANG Zong-qiong, ZHENG Xiao-ming, PANG Hong-bo. Identification of Rice Plant Height-associated QTL Using BSA-seq and RNA-seq [J]. Biotechnology Bulletin, 2023, 39(8): 173-184.
[6]	YAO Sha-sha, WANG Jing-jing, WANG Jun-jie, LIANG Wei-hong. Molecular Mechanisms of Rice Grain Size Regulation Related to Plant Hormone Signaling Pathways [J]. Biotechnology Bulletin, 2023, 39(8): 80-90.
[7]	LI Yu, LI Su-zhen, CHEN Ru-mei, LU Hai-qiang. Advances in the Regulation of Iron Homeostasis by bHLH Transcription Factors in Plant [J]. Biotechnology Bulletin, 2023, 39(7): 26-36.
[8]	LIANG Cheng-gang, WANG Yan, LI Tian, OHSUGI Ryu, AOKI Naohiro. Effect of SP1 on Panicle Architecture by Regulating Carbohydrate Remobilization [J]. Biotechnology Bulletin, 2023, 39(5): 152-159.
[9]	ZHOU Ding-ding, LI Hui-hu, TANG Xing-yong, YU Fa-xin, KONG Dan-yu, LIU Yi. Research Progress in the Biosynthesis and Regulation of Glycyrrhizic Acid and Liquiritin [J]. Biotechnology Bulletin, 2023, 39(5): 44-53.
[10]	YANG Mao, LIN Yu-feng, DAI Yang-shuo, PAN Su-jun, PENG Wei-ye, YAN Ming-xiong, LI Wei, WANG Bing, DAI Liang-ying. OsDIS1 Negatively Regulates Rice Drought Tolerance Through Antioxidant Pathways [J]. Biotechnology Bulletin, 2023, 39(2): 88-95.
[11]	JIANG Min-xuan, LI Kang, LUO Liang, LIU Jian-xiang, LU Hai-ping. Advances on the Expressions of Foreign Proteins in Plants [J]. Biotechnology Bulletin, 2023, 39(11): 110-122.
[12]	JIANG Nan, SHI Yang, ZHAO Zhi-hui, LI Bin, ZHAO Yi-hui, YANG Jun-biao, YAN Jia-ming, JIN Yu-fan, CHEN Ji, HUANG Jin. Expression and Functional Analysis of OsPT1 Gene in Rice Under Cadmium Stress [J]. Biotechnology Bulletin, 2023, 39(1): 166-174.
[13]	CHEN Guang, LI Jia, DU Rui-ying, WANG Xu. Identification and Gene Functional Analysis of Salinity-hypersensitive Mutant ss2 in Rice [J]. Biotechnology Bulletin, 2022, 38(9): 158-166.
[14]	GAO Xiao-rong, DING Yao, LV Jun. Effects of Pseudomonas sp. PR3,a Pyrene-degrading Bacterium with Plant Growth-promoting Properties,on Rice Growth Under Pyrene Stress [J]. Biotechnology Bulletin, 2022, 38(9): 226-236.
[15]	HUANG Jing, ZHU Liang, XUE Peng-bo, FU Qiang. Research on Mechanism and QTL Mapping Associated with Cadmium Accumulation in Rice Leaves and Grains [J]. Biotechnology Bulletin, 2022, 38(8): 118-126.