Functional Studies of the Gossypium hirsutumGhNFD4 Gene in Response to Drought in Cotton

doi:10.13560/j.cnki.biotech.bull.1985.2024-0839

Abstract

Abstract:

Objective To analyze the biological function of GhNFD4 in response to drought stress in terrestrial cotton, and to provide genetic resources and theoretical basis for molecular breeding of terrestrial cotton for stress tolerance. Method Real-time fluorescence quantitative PCR (RT-qPCR) was used to detect the expression pattern of GhNFD4 in cotton seedlings under PEG-mimicked natural drought stress; tobacco crisped virus (TRV)-induced gene silencing (VIGS) was utilized to explore the regulatory role of GhNFD4 in drought stress, and the interfering sequences of GhNFD4 were cloned and the gene silencing vectors were constructed. The GhNFD4 silencing plants were further obtained by infiltrating cotton seedlings through transient transfection technology, observing the phenotypic differences between silencing plants and control plants at 15 d of natural water loss, detecting the accumulation of ROS products by using NBT and DAB staining, and detecting the water loss rate and drought-related physiological indexes of isolated leaves. Result The expression of GhNFD4 was induced by natural drought stress simulated by PEG and peaked at the 12th h of stress. After 15 d of natural drought, the leaves of GhNFD4-silenced plants showed more severe wilting and darker coloring after NBT and DAB staining compared with the negative control plants, and the water loss rate of the isolated leaves and the relative electrical conductivity (REL), malondialdehyde (MDA), and hydrogen peroxide (H₂O₂) contents of the leaves after drought stress were significantly higher compared with the control, and the total antioxidant enzyme (T-AOC) activity was significantly lower compared with the control activity was significantly decreased compared with the control group. Conclusion GhNFD4 is induced by drought stress and actively participates in the positive regulation of drought stress in cotton by regulating the activity of antioxidant enzymes under drought conditions, which improves the resistance of cotton to drought stress.

Key words: Gossypium hirsutum, GhNFD4, drought, gene expression, VIGS

MA Li-hua, HOU Meng-juan, ZHU Xin-xia. Functional Studies of the Gossypium hirsutumGhNFD4 Gene in Response to Drought in Cotton[J]. Biotechnology Bulletin, 2025, 41(3): 104-111.

Figures/Tables 6

Table 1 Primers used in this study

引物名称 Primer name	引物序列 Primer sequence （5′-3′）	用途Purpose
GhUBQ7-F	AGAGGTCGAGTCTTGGGACA	内参基因Reference gene
GhUBQ7-R	GCTTGATCTTCTTGGGCTTG	内参基因Reference gene
GhNFD4-F	AAACCTTGTCACTTGGGCGA	实时荧光定量PCR RT-qPCR
GhNFD4-R	CTTTCGGGTACTTCCCTCCG	实时荧光定量PCR RT-qPCR
GhNFD4-EcoRＩF	CGGAATTCGACAAAGAGGGCCAAAGATGC	基因克隆 Gene cloning
GhNFD4-BamHＩR	CGGGATCCTCACCCCACTCTCCATTTTGT	基因克隆 Gene cloning

Fig. 1 Relative expressions of GhNFD4 under PEG mock treatment

Fig. 2 Construction of GhNFD4 silencing vectorA: 1: Negative control; 2-4: cloning of GhNFD4 silencing fragment. B: 1-2: pTRV2-GhNFD4 (TRV2-NFD4-1) control and digest; 3-4: pTRV2-GhNFD4 (TRV2-NFD4-3) control and digest. M: Marker 3000

Fig. 3 Establishment of VIGS silencing system and detection of VIGS silencing efficiencyA: Cotton albino phenotype injected with pTRV1/pTRV2-GhCLA1. B: RT-qPCR analysis of GhNFD4 in WT, TRV2-00 and VIGS plants (TRV2-GhNFD4-1, TRV2-GhNFD4-3).**P<0.01. The same below

Fig. 4 Drought stress phenotypes of GhNFD4 silenced plants

Fig. 5 Determination for the physiological indices of GhNFD4 gene-silenced plants measured after 15 d of drought stressA: Water loss rate of isolated leaves. B: Relative electrical conductivity. C: Malondialdehyde content (MDA). D: DAB and NBT staining of VIGS and control plants after drought stress. E: Hydrogen peroxide content (H2O2). F: Total antioxidant capacity (T-AOC)

References 33

1	Bashir K, Matsui A, Rasheed S, et al. Recent advances in the characterization of plant transcriptomes in response to drought, salinity, heat, and cold stress [J]. F1000Res, 2019, 8(F1000 Faculty Rev): 658.
2	Mahmood U, Li XD, Fan YH, et al. Multi-omics revolution to promote plant breeding efficiency [J]. Front Plant Sci, 2022, 13: 1062952.
3	Abdelraheem A, Esmaeili N, O’Connell M, et al. Progress and perspective on drought and salt stress tolerance in cotton [J]. Ind Crops Prod, 2019, 130: 118-129.
4	Ergashovich KA, Azamatovna BZ, Toshtemirovna NU, et al. Ecophysiological effects of water deficiency on cotton varieties [J]. J Crit Rev, 2020, 7(9): 244-246.
5	Sajid M, Amjid M, Munir H, et al. Comparative analysis of growth and physiological responses of sugarcane elite genotypes to water stress and sandy loam soils [J]. Plants (Basel), 2023, 12(15): 2759.
6	Fang YJ, Liao KF, Du H, et al. A stress-responsive NAC transcription factor SNAC3 confers heat and drought tolerance through modulation of reactive oxygen species in rice [J]. J Exp Bot, 2015, 66(21): 6803-6817.
7	Deeba F, Pandey AK, Ranjan S, et al. Physiological and proteomic responses of cotton (Gossypium herbaceum L.) to drought stress [J]. Plant Physiol Biochem, 2012, 53: 6-18.
8	Hussain S, Hussain S, Qadir T, et al. Drought stress in plants: an overview on implications, tolerance mechanisms and agronomic mitigation strategies [J]. Plant Sci Today, 2019, 6(4): 389-402.
9	Ozturk M, Turkyilmaz Unal B, García-Caparrós P, et al. Osmoregulation and its actions during the drought stress in plants [J]. Physiol Plant, 2021, 172(2): 1321-1335.
10	Pao SS, Paulsen IT, Jr Saier MH. Major facilitator superfamily [J]. Microbiol Mol Biol Rev, 1998, 62(1): 1-34.
11	Quistgaard EM, Löw C, Guettou F, et al. Understanding transport by the major facilitator superfamily (MFS): structures pave the way [J]. Nat Rev Mol Cell Biol, 2016, 17(2): 123-132.
12	Hwang JU, Song WY, Hong D, et al. Plant ABC transporters enable many unique aspects of a terrestrial plant’s lifestyle [J]. Mol Plant, 2016, 9(3): 338-355.
13	Guo RZ, Zhang Q, Qian K, et al. Phosphate-dependent regulation of vacuolar trafficking of OsSPX-MFSs is critical for maintaining intracellular phosphate homeostasis in rice [J]. Mol Plant, 2023, 16(8): 1304-1320.
14	Julião MHM, Silva SR, Ferro JA, et al. A genomic and transcriptomic overview of mate, abc, and MFS transporters in Citrus sinensis interaction with Xanthomonas citri subsp. citri [J]. Plants (Basel), 2020, 9(6): 794.
15	Boorer KJ, Loo DD, Wright EM. Steady-state and presteady-state kinetics of the H⁺/hexose cotransporter (STP1) from Arabidopsis thaliana expressed in Xenopus oocytes [J]. J Biol Chem, 1994, 269(32): 20417-20424.
16	Cordoba E, Aceves-Zamudio DL, Hernández-Bernal AF, et al. Sugar regulation of sugar transporter protein 1 (stp1) expression in Arabidopsis thaliana [J]. J Exp Bot, 2015, 66(1): 147-159.
17	Büttner M, Truernit E, Baier K, et al. AtSTP3, a green leaf-specific, low affinity monosaccharide-H⁺ symporter of Arabidopsis thaliana [J]. Plant Cell Environ, 2000, 23(2): 175-184.
18	Segonzac C, Boyer JC, Ipotesi E, et al. Nitrate efflux at the root plasma membrane: identification of an Arabidopsis excretion transporter [J]. Plant Cell, 2007, 19(11): 3760-3777.
19	Liu WW, Sun Q, Wang K, et al. Nitrogen Limitation Adaptation (NLA) is involved in source-to-sink remobilization of nitrate by mediating the degradation of NRT1.7 in Arabidopsis [J]. New Phytol, 2017, 214(2): 734-744.
20	Taochy C, Gaillard I, Ipotesi E, et al. The Arabidopsis root stele transporter NPF2.3 contributes to nitrate translocation to shoots under salt stress [J]. Plant J, 2015, 83(3): 466-479.
21	Liu TY, Huang TK, Yang SY, et al. Identification of plant vacuolar transporters mediating phosphate storage [J]. Nat Commun, 2016, 7: 11095.
22	Lu JY, Wang CL, Wang HY, et al. OsMFS1/OsHOP2 complex participates in rice male and female development [J]. Front Plant Sci, 2020, 11: 518.
23	Kong H, Hou MJ, Ma B, et al. Calcium-dependent protein kinase GhCDPK4 plays a role in drought and abscisic acid stress responses [J]. Plant Sci, 2023, 332: 111704.
24	Mandel MA, Feldmann KA, Herrera-Estrella L, et al. CLA1 a novel gene required for chloroplast development, is highly conserved in evolution [J]. Plant J, 1996, 9(5): 649-658.
25	Wei TL, Wang Y, Xie ZZ, et al. Enhanced ROS scavenging and sugar accumulation contribute to drought tolerance of naturally occurring autotetraploids in Poncirus trifoliata [J]. Plant Biotechnol J, 2019, 17(7): 1394-1407.
26	Zou LP, Qi DF, Sun JB, et al. Expression of the cassava nitrate transporter NRT2.1 enables Arabidopsis low nitrate tolerance [J]. J Genet, 2019, 98: 74.
27	Yan HL, Xu WX, Xie JY, et al. Variation of a major facilitator superfamily gene contributes to differential cadmium accumulation between rice subspecies [J]. Nat Commun, 2019, 10(1): 2562.
28	Zhang XM, Feng JJ, Zhao RL, et al. Functional characterization of the GhNRT2.1e gene reveals its significant role in improving nitrogen use efficiency in Gossypium hirsutum [J]. PeerJ, 2023, 11: e15152.
29	Liu FJ, Cai S, Dai LJ, et al. Two PHOSPHATE-TRANSPORTER1 genes in cotton enhance tolerance to phosphorus starvation [J]. Plant Physiol Biochem, 2023, 204: 108128.
30	Qiao KK, Lv JY, Chen LL, et al. GhSTP18, a member of sugar transport proteins family, negatively regulates salt stress in cotton [J]. Physiol Plant, 2023, 175(4): e13982.
31	Chen BZ, Wang XY, Lv JY, et al. GhN/AINV13 positively regulates cotton stress tolerance by interacting with the 14-3-3 protein [J]. Genomics, 2021, 113(1 Pt 1): 44-56.
32	Zhang Q, Ma C, Wang X, et al. Genome-wide identification of the light-harvesting chlorophyll a/b binding (Lhc) family in Gossypium hirsutum reveals the influence of GhLhcb2.3 on chlorophyll a synthesis [J]. Plant Biol, 2021, 23(5): 831-842.
33	Hano C, Drouet S, Lainé E. Virus-induced gene silencing (VIGS) in flax (Linum usitatissimum L.) seed coat: description of an effective procedure using the transparent testa 2 gene as a selectable marker [J]. Methods Mol Biol, 2020, 2172: 233-242.

[1]	LIU Jie, WANG Fei, TAO Ting, ZHANG Yu-jing, CHEN Hao-ting, ZHANG Rui-xing, SHI Yu, ZHANG Yi. Overexpression of SlWRKY41 Improves the Tolerance of Tomato Seedlings to Drought [J]. Biotechnology Bulletin, 2025, 41(2): 107-118.
[2]	HUANG Ying, YU Wen-jing, LIU Xue-feng, DIAO Gui-ping. Bioinformatics and Expression Pattern Analysis of Glutathione S-transferase in Populus davidiana × P. bolleana [J]. Biotechnology Bulletin, 2025, 41(2): 248-256.
[3]	DING Ruo-xi, DOU Shuo, AN Ye-zhi, KONG Wen-hui, GUO Wen-jing, ZHANG Dong-mei, WANG Xing-fen, MA Zhi-ying, WU Li-zhu. Extended Research on the Application of VIGS Technology in the Whole Growth Cycle of Cotton [J]. Biotechnology Bulletin, 2025, 41(2): 58-64.
[4]	KONG Qing-yang, ZHANG Xiao-long, LI Na, ZHANG Chen-jie, ZHANG Xue-yun, YU Chao, ZHANG Qi-xiang, LUO Le. Identification and Expression Analysis of GRAS Transcription Factor Family in Rosa persica [J]. Biotechnology Bulletin, 2025, 41(1): 210-220.
[5]	ZHANG Man-yu, DONG Jia-cheng, GOU Fu-fan, GONG Chao-hui, LIU Qian, SUN Wen-liang, KONG zhen, HAO Jie, WANG Min, TIAN Chao-guang. Cloning, Expression, Characterization and Application of the Pectin Esterase MtCE12-1 from Myceliophthora thermophila [J]. Biotechnology Bulletin, 2024, 40(9): 291-300.
[6]	WANG Qian, ZHOU Jia-yan, WANG Qian, DENG Yu-ping, ZHANG Min-hui, CHEN Jing, YANG Jun, ZOU Jian. Identification and Expression Analysis of the YABBY Gene Family in Sunflower [J]. Biotechnology Bulletin, 2024, 40(8): 199-211.
[7]	HAN Kai, ZHOU Yong-shun, ZHANG Kai-yue, WANG Lu, GAO Jian-feng, CHEN Fu-long. Evaluation of Drought Resistance of Three Chlorella Strains [J]. Biotechnology Bulletin, 2024, 40(8): 244-254.
[8]	YANG Wei, ZHAO Li-fen, TANG Bing, ZHOU Lin-bi, YANG Juan, MO Chuan-yuan, ZHANG Bao-hui, LI Fei, RUAN Song-lin, DENG Ying. Genome-wide Identification and Expression Analysis of the SRO Gene Family in Brassica juncea L. [J]. Biotechnology Bulletin, 2024, 40(8): 129-141.
[9]	HU Ya-dan, WU Guo-qiang, LIU Chen, WEI Ming. Roles of MYB Transcription Factor in Regulating the Responses of Plants to Stress [J]. Biotechnology Bulletin, 2024, 40(6): 5-22.
[10]	QIN Jian, LI Zhen-yue, HE Lang, LI Jun-ling, ZHANG Hao, DU Rong. Change of Single-cell Transcription Profile and Analysis of Intercellular Communication in Myogenic Cell Differentiation [J]. Biotechnology Bulletin, 2024, 40(6): 330-342.
[11]	WEN Jie, DU Yuan-xin, WU An-bo, YANG Guang-rong, LU Min, AN Hua-ming, NAN Hong. Identification and Expression Pattern Analysis of Rosa roxburghii SOD Gene Family [J]. Biotechnology Bulletin, 2024, 40(5): 153-166.
[12]	CHEN Chun-lin, LI Bai-xue, LI Jin-ling, DU Qing-jie, LI Meng, XIAO Huai-juan. Identification and Expression Analysis of Epidermal Patterning Factor (EPF) Genes in Cucumis melo [J]. Biotechnology Bulletin, 2024, 40(4): 130-138.
[13]	CHEN Qiang, HUANG Xin-hui, ZHANG Zheng, ZHANG Chong, LIU Ye-fei. Effects of Melatonin on the Fruit Softening and Ethylene Synthesis of Post-harvest Oriental Melon [J]. Biotechnology Bulletin, 2024, 40(4): 139-147.
[14]	YANG Wei-cheng, SUN Yan, YANG Qian, WANG Zhuang-lin, MA Ju-hua, XUE Jin-ai, LI Run-zhi. Genome-wide Identification of the FAX family in Gossypium hirsutum and Functional Analysis of GhFAX1 [J]. Biotechnology Bulletin, 2024, 40(3): 155-169.
[15]	ZHANG Yu, SHI Lei, GONG Lei, NIE Feng-jie, YANG Jiang-wei, LIU Xuan, YANG Wen-jing, ZHANG Guo-hui, XIE Rui-xia, ZHANG Li. Genome-wide Identification of Potato WOX Gene Family and Its Expression Analysis in in vitro Regeneration and Abiotic Stress [J]. Biotechnology Bulletin, 2024, 40(3): 170-180.