Identification and Functional Analysis of Gravity Response Regulatory Genes in Potato

doi:10.13560/j.cnki.biotech.bull.1985.2025-0003

Abstract

Abstract:

Objective This study aims to provide a reference for elucidating the molecular mechanisms underlying gravity response in potato (Solanum tuberosum L.) and to offer potential genetic resources for the genetic improvement and breeding of potato. Method Paraffin sectioning was employed to examine the histological structures of potato stolons and aerial stems. Gravity-responsive regulatory genes in potato were identified through homology alignment, with their expressions validated by RT-qPCR. Expression patterns were further analyzed using transcriptome sequencing. Utilizing the tetraploid potato variety Desiree as a background, we constructed transgenic lines that overexpressed the gravity-responsive key gene StLAZY1-1, followed by observation and statistical analysis of their phenotypes. Result Significant morphological differences in tissue structure were observed between the stolon and aerial stem, particularly regarding the arrangement of vascular tissues and the deposition of starch granules. Gravity-responsive genes, including PRAF/RLD FAMILY MEMBER (RLD), SCARECROW (SCR), SHOOT-ROOT (SHR), BRX-LIKE4 (BRXL4), and PIN-FORMED3 (PIN3), demonstrated conserved domains and distribution patterns across various species, whereas LAZY family genes displayed diverse domain distributions. The expressions of gravity-responsive genes were found to be tissue-specific and regulated by light signals. Functional verification of the StLAZY1-1 gene in transgenic potato lines demonstrated significant alterations in plant height and stolon number when compared to wild-type plants. Conclusion The key gravity-responsive regulatory gene StLAZY1-1 in potato influences plant height and the number of stolons.

Key words: potato, gravity response, LAZY1-1 gene, paraffin sectioning

LUO Ji-lin, LI Jin-ye, JIA Yu-xin. Identification and Functional Analysis of Gravity Response Regulatory Genes in Potato[J]. Biotechnology Bulletin, 2025, 41(6): 109-118.

Figures/Tables 7

Table 1 Primer sequences for RT-qPCR

基因名称Gene name	引物名称 Primer name	引物序列Primer sequence（5'-3'）
StACTIN	Stactin-F	GGGATGGAGAAGTTTGGTGGTGG
StACTIN	Stactin-R	CTTCGACCAAGGGATGGTGTAGC
StBRXL4	BRXL4-qRT-F	TGCCAGTGATGTTGAGACTGA
StBRXL4	BRXL4-qRT-R	TGGGCAGTGCAGGATCTTTT
StLAZY1-1	LAZY1-1-qRT-F	TTCAGCAGAGCCAAAACCCC
StLAZY1-1	LAZY1-1-qRT-R	TTTGAGAGGCGATGGTGAGG
StLAZY2	LAZY2-qRT-F	GCGAGACACACTTCCCGAAT
StLAZY2	LAZY2-qRT-R	ATCCGAATCGGTTTTGACCCA
StLAZY5	LAZY5-qRT-F	CGGTGGAGAAAAGAAAGAACGA
StLAZY5	LAZY5-qRT-R	TTGCCCTGTTCCTGAAGTTGA
StLAZY6	LAZY6-qRT-F	GCCATAATAGCACCAGCAGTTT
StLAZY6	LAZY6-qRT-R	TGGCGTTGGAGGGTCAGTA
StPIN3	PIN3-qRT-F	TCGGATGTTGGTTTCTGACCA
StPIN3	PIN3-qRT-R	ATGTGGAGCTAGACCCCAGT
StRLD1	RLD1-qRT-F	TTCTCTGCCTTCTGGCAACC
StRLD1	RLD1-qRT-R	CTTGGTGCTCCCCGAATCTT
StRLD2	RLD2-qRT-F	GCTGGAGAAGAGACTGCCAA
StRLD2	RLD2-qRT-R	GCAGTGAGATTGGAACCCGA
StSCR	SCR-qRT-F	GCCGAGAGATTAGGCCTTCC
StSCR	SCR-qRT-R	ACCTTCGGAGCCAACCTTTG
StSHR	SHR-qRT-F	GACACAACAATCTCAATCTCATCA
StSHR	SHR-qRT-R	ACATCCACATGAGTTGTTGGAC

Fig. 1 Anatomy of potato stem and stolonA: Young stem. B: Mature stem. C: Creeping stem

Fig. 2 Aligment of domains in gravity response regulatory genes

Fig. 3 Expression pattern of gravity-responsive regulatory genes in potatoA: RT-qPCR detects expression pattern in tissues of potato; B: RNA-seq detects expression pattern in tissues of potato. LD refers to long day, SD refers to short day

Fig. 4 Phylogenetic tree of proteins in the LAZY family

Fig. 5 StLAZY1-1 expression patterns in the stolon of different developmental morphology of potatoA: Schematic diagram of underground organization of potato part. B: The expression of StLAZY1-1 was detected by RT-qPCR, one-way ANOVA was used, *P<0.05, **P<0.01,***P<0.001, ****P<0.000 1, the same below

Fig. 6 Identification and phenotypic statistics of LAZY1-1OE positive plantsA: Detection of LAZY1-1-positive plants in the Desiree background; B: Phenotypic statistics of transgenic plants in the Desiree background

References 32

33	Xu R, Sun CQ. What happened during domestication of wild to cultivated rice [J]. Crop J, 2021, 9(3): 564-576.
34	Li PJ, Wang YH, Qian Q, et al. LAZY1 controls rice shoot gravitropism through regulating polar auxin transport [J]. Cell Res, 2007, 17(5): 402-410.
35	Yoshihara T, Spalding EP. LAZY genes mediate the effects of gravity on auxin gradients and plant architecture [J]. Plant Physiol, 2017, 175(2): 959-969.
1	Vandenbrink JP, Kiss JZ. Plant responses to gravity [J]. Semin Cell Dev Biol, 2019, 92: 122-125.
2	Volkmann D, Baluska F. Gravity: one of the driving forces for evolution [J]. Protoplasma, 2006, 229(2-4): 143-148.
3	Hangarter RP. Gravity, light and plant form [J]. Plant Cell Environ, 1997, 20(6): 796-800.
4	ARWIN F. The statolith-theory of geotropism [J]. Proc R Soc Lond, 1903, 71(467-476): 362-373.
5	Roychoudhry S, Kepinski S. Shoot and root branch growth angle control-the wonderfulness of lateralness [J]. Curr Opin Plant Biol, 2015, 23: 124-131.
6	Emerson R, Beadle G, Fraser AC. A summary of linkage studies in maize [J]. Cornell Agricultural Experiment, 1935,180:83.
7	Dong ZB, Jiang C, Chen XY, et al. Maize LAZY1 mediates shoot gravitropism and inflorescence development through regulating auxin transport, auxin signaling, and light response [J]. Plant Physiol, 2013, 163(3): 1306-1322.
8	Fukaki H, Fujisawa H, Tasaka M. SGR1, SGR2, SGR3: novel genetic loci involved in shoot gravitropism in Arabidopsis thaliana [J]. Plant Physiol, 1996, 110(3): 945-955.
9	Zhang H, Li X, Sang DJ, et al. PROG1 acts upstream of LAZY1 to regulate rice tiller angle as a repressor [J]. Crop J, 2023, 11(2): 386-393.
10	Chen JY, Yu RB, Li N, et al. Amyloplast sedimentation repolarizes LAZYs to achieve gravity sensing in plants [J]. Cell, 2023, 186(22): 4788-4802.e15.
11	Hollender CA, Hill JL Jr, Waite J, et al. Opposing influences of TAC1 and LAZY1 on lateral shoot orientation in Arabidopsis [J]. Sci Rep, 2020, 10(1): 6051.
12	Taniguchi M, Furutani M, Nishimura T, et al. The Arabidopsis LAZY1 family plays a key role in gravity signaling within statocytes and in branch angle control of roots and shoots [J]. Plant Cell, 2017, 29(8): 1984-1999.
13	Yoshihara T, Spalding EP, Iino M. AtLAZY1 is a signaling component required for gravitropism of the Arabidopsis thaliana inflorescence [J]. Plant J, 2013, 74(2): 267-279.
14	Furutani M, Hirano Y, Nishimura T, et al. Polar recruitment of RLD by LAZY1-like protein during gravity signaling in root branch angle control [J]. Nat Commun, 2020, 11(1): 76.
15	Che XM, Splitt BL, Eckholm MT, et al. BRXL4-LAZY1 interaction at the plasma membrane controls Arabidopsis branch angle and gravitropism [J]. Plant J, 2023, 113(2): 211-224.
16	Caspar T, Pickard BG. Gravitropism in a starchless mutant of Arabidopsis: implications for the starch-statolith theory of gravity sensing [J]. Planta, 1989, 177: 185-197.
17	Vitha S, Yang M, Sack FD, et al. Gravitropism in the starch excess mutant of Arabidopsis thaliana [J]. Am J Bot, 2007, 94(4): 590-598.
18	Zhu L, Yin T, Zhang MJ, et al. Genome-wide identification and expression pattern analysis of the kiwifruit GRAS transcription factor family in response to salt stress [J]. BMC Genomics, 2024, 25(1): 12.
19	Fukaki H, Wysocka-Diller J, Kato T, et al. Genetic evidence that the endodermis is essential for shoot gravitropism in Arabidopsis thaliana [J]. Plant J, 1998, 14(4): 425-430.
20	Johri MM. Hormonal regulation in green plant lineage families [J]. Physiol Mol Biol Plants, 2008, 14(1-2): 23-38.
21	Friml J, Wiśniewska J, Benková E, et al. Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis [J]. Nature, 2002, 415(6873): 806-809.
22	Zažímalová E, Křeček P, Skůpa P, et al. Polar transport of the plant hormone auxin-the role of PIN-FORMED (PIN) proteins [J]. Cell Mol Life Sci, 2007, 64(13): 1621-1637.
23	Horton D. Underground crops: Long-term trends in production of roots and tubers [J]. Winrock International, 1988,7-9.
24	Navarro C, Abelenda JA, Cruz-Oró E, et al. Control of flowering and storage organ formation in potato by FLOWERING LOCUS T [J]. Nature, 2011, 478(7367): 119-122.
25	Zierer W, Rüscher D, Sonnewald U, et al. Tuber and tuberous root development [J]. Annu Rev Plant Biol, 2021, 72: 551-580.
26	Xu X, Vreugdenhil D, Lammeren AAMV. Cell division and cell enlargement during potato Tuber formation [J]. J Exp Bot, 1998, 49(320): 573-582.
27	Abelenda JA, Bergonzi S, Oortwijn M, et al. Source-sink regulation is mediated by interaction of an FT homolog with a SWEET protein in potato [J]. Curr Biol, 2019, 29(7): 1178-1186.e6.
28	Tang D, Jia YX, Zhang JZ, et al. Genome evolution and diversity of wild and cultivated potatoes [J]. Nature, 2022, 606(7914): 535-541.
29	叶明旺, 张春芝, 黄三文. 二倍体栽培马铃薯高效遗传转化体系的建立 [J]. 中国农业科学, 2018, 51(17): 3249-3257.
	Ye MW, Zhang CZ, Huang SW. Construction of high efficient genetic transformation system for diploid potatoes [J]. Sci Agric Sin, 2018, 51(17): 3249-3257.
30	Overbeek JV. “Lazy,” an a-geotropic form of maize [J]. J Hered, 1936, 27(3): 93-96.
31	Howard TP 3rd, Hayward AP, Tordillos A, et al. Identification of the maize gravitropism gene lazy plant1 by a transposon-tagging genome resequencing strategy [J]. PLoS One, 2014, 9(1): e87053.
32	Huang X, Kurata N, Wei X, et al. A map of rice genome variation reveals the origin of cultivated rice[J]. Nature, 2012, 490(7421):497-501.

[1]	SONG Hui-yang, SU Bao-jie, LI Jing-hao, MEI Chao, SONG Qian-na, CUI Fu-zhu, FENG Rui-yun. Cloning and Functional Analysis of the StAS2-15 Gene in Potato under Salt Stress [J]. Biotechnology Bulletin, 2025, 41(5): 119-128.
[2]	WEN Bo-lin, WAN Min, HU Jian-jun, WANG Ke-xiu, JING Sheng-lin, WANG Xin-yue, ZHU Bo, TANG Ming-xia, LI Bing, HE Wei, ZENG Zi-xian. Establishment of Genetic Transformation and Gene Editing System for a Potato Cultivar Chuanyu 50 [J]. Biotechnology Bulletin, 2025, 41(4): 88-97.
[3]	LIU Tao, WANG Zhi-qi, WU Wen-bo, SHI Wen-ting, WANG Chao-nan, DU Chong, YANG Zhong-min. Identification and Expression Analysis of the GRAM Gene Family in Potato [J]. Biotechnology Bulletin, 2025, 41(4): 145-155.
[4]	ZHANG Yi-xuan, MA Yu, WANG Tong-tong, SHENG Su-ao, SONG Jia-feng, LYU Zhao-yan, ZHU Xiao-biao, HOU Hua-lan. Genome-wide Identification and Expression Profiles of DIR Gene Family in Potato [J]. Biotechnology Bulletin, 2025, 41(3): 123-136.
[5]	YU Ting, HUANG Dan-dan, ZHU Yan-hui, YANG Mei-hong, AI Ju, GAO Dong-li. Screening and Interaction Verification of Transcription Factors Stpatatin 05 Gene in Potato [J]. Biotechnology Bulletin, 2025, 41(3): 137-145.
[6]	QIN Yue, YANG Yan, ZHANG Lei, LU Li-li, LI Xian-ping, JIANG Wei. Identification and Comparative Analysis of the StGAox Genes in Diploid and Tetraploid Potatoes [J]. Biotechnology Bulletin, 2025, 41(3): 146-160.
[7]	SHEN Peng, GAO Ya-Bin, DING Hong. Identification and Expression Analysis of SAT Gene Family in Potato（Solanum tuberosum L.） [J]. Biotechnology Bulletin, 2024, 40(9): 64-73.
[8]	SONG Bing-fang, LIU Ning, CHENG Xin-yan, XU Xiao-bin, TIAN Wen-mao, GAO Yue, BI Yang, WANG Yi. Identification of Potato G6PDH Gene Family and Its Expression Analysis in Damaged Tubers [J]. Biotechnology Bulletin, 2024, 40(9): 104-112.
[9]	WANG Chao, BAI Ru-qian, GUAN Jun-mei, LUO Ji-lin, HE Xue-jiao, CHI Shao-yi, MA Ling. Promotion of StHY5 in the Synthesis of SGAs during Tuber Turning-green of Potato [J]. Biotechnology Bulletin, 2024, 40(9): 113-122.
[10]	XIA Shi-xuan, GENG Ze-dong, ZHU Guang-tao, ZHANG Chun-zhi, LI Da-wei. Quick Detection of Potato Pollen Viability Based on Deep Learning [J]. Biotechnology Bulletin, 2024, 40(9): 123-130.
[11]	MAO Xiang-hong, LU Yao, FAN Xiang-bin, DU Pei-bing, BAI Xiao-dong. Genetic Diversity Analysis of Potato Varieties Based on SSR Fluorescent Marker Capillary Electrophoresis and Construction of Molecular Identity Card [J]. Biotechnology Bulletin, 2024, 40(9): 131-140.
[12]	YUAN Lan, HUANG Ya-nan, ZHANG Bei-ni, XIONG Yu-meng, WANG Hong-yang. High-throughput Sample Preparation Method for the Identification of Potato Ploidy Using Flow Cytometry [J]. Biotechnology Bulletin, 2024, 40(9): 141-147.
[13]	SONG Qian-na, DUAN Yong-hong, FENG Rui-yun. Establishment of CRISPR/Cas9-mediated Highly Efficient Gene Editing System in Microtubers of Potatoes [J]. Biotechnology Bulletin, 2024, 40(9): 33-41.
[14]	WANG Ke-ran, YAN Jun-jie, LIU Jian-feng, GAO Yu-lin. Application and Risk of RNAi Technology in Potato Insect Pest Management [J]. Biotechnology Bulletin, 2024, 40(9): 4-10.
[15]	ZHANG Xiao-mei, ZHOU Nan-ling, ZHANG Sai-hang, WANG Chao, SHEN Yu-long, GUAN Jun-mei, MA Ling. Cloning and Expression Analysis of StDREBs Gene in Solanum tuberosum L. [J]. Biotechnology Bulletin, 2024, 40(9): 42-50.