AtSCL4,an Arabidopsis thaliana GRAS Transcription Factor,Negatively Modulates Plants in Response to Osmotic Stress

doi:10.13560/j.cnki.biotech.bull.1985.2021-0963

Abstract

Abstract:

Exploring the biological function of Arabidopsis thaliana GRAS transcription factor AtSCL4 in response to osmotic stress would lay foundation for studying the function of GRAS protein in abiotic stresses. Wild-type and AtSCL4 mutant were used as experimental materials,and physiological index determination and qRT-PCR methods were applied to study the biological mechanism of AtSCL4 regulating plant osmosis resistance. The study revealed that AtSCL4 was significantly up-regulated by osmotic stress,and mutants of AtSCL4 showed improved osmotic resistance than WT. In response to osmotic stress,AtSCL4 negatively regulated AtMYB61 expression to increase stomatal closure,resulting in reducing water loss. Furthermore,AtSCL4 improved proline and betaine levels by regulating the transcripts of P5SC1 and BADH. In addition,AtSCL4 increased antioxidant enzyme activity by negatively regulating AtSOD1 and PER4 expressions,leading to the decrease of reactive oxygen. AtSCL4 negatively modulated osmotic stress tolerance via the induction of stress-responsive genes and physiological changes.

Key words: Arabidopsis thaliana, osmotic stress, GRAS transcription factor, stomatal aperture, ROS

XU Hong-yun, ZHANG Ming-yi. AtSCL4,an Arabidopsis thaliana GRAS Transcription Factor,Negatively Modulates Plants in Response to Osmotic Stress[J]. Biotechnology Bulletin, 2022, 38(6): 129-135.

Figures/Tables 7

Table 1 Primer sequences used in qRT-PCR

引物名称 Primer name	引物序列Primer sequence（5'-3'）
AtSCL4-F	ATGGCTTACATGTGCACTGATAG
AtSCL4-R	TTATCGCCAGGAAGAAAGAGTG
ATMYB61-F	GATTGCGTCAAGGCTTCCG
ATMYB61-R	CGCAGAAGAGGAACTAGGAG
P5CS1-F	GTCAAGTCTATGCTTGATTTG
P5CS1-R	GATTTGTCGCCGAATGTAATC
BADH-F	GCTGACCTAGCTGAAGGCTTG
BADH-R	CACCTCGCGGCAAATATCAGC
SOD1-F	GTCCACATTTCAACCCCGATG
SOD1-R	GAGACCAATGATGCCGCAAGC
PER4-F	GAAGGTTGGTCGAAGAGATTC
PER4-R	CGTATCTCCACCGTTGACCGG
Act7-F	ATGTTCACCACTACCGCAG
Act7-R	ACCTCAGGACAACGGAATCTC
Tub2-F	GTCTCCAAGGGTTCCAGGTT
Tub2-R	GACAGAGTAGCGTTGTAAGGC

Fig. 1 Expression profiles of AtSCL4 at different times in response to mannitol stress *：Indicates difference significant at P< 0.05. The same below

Fig. 2 Expression analysis of AtSCL4 in mutants KO1-KO8 are different mutant lines

Fig. 3 Analysis of seedling germination and growth regulated by AtSCL4 under osmotic stress A：Observation of the germination phenotypes on plate medium. B：Statistics of germination. C：Observation of root length. D：Statistics of root length and fresh weight

Fig. 4 Stomatal aperture assay of seedlings regulated by AtSCL4 under osmotic stress A：Determination of water loss rate. B：Observation of stomatal aperture.C：Determination of stomatal aperture. D：Expression of AtMYB61 related to stomatal aperture regulation

Fig. 5 Synthesis analysis of osmolyte in seedlings mediated by AtSCL4 under osmotic stress A：Proline content. B：Betaine content. C：Expressions of of P5CS1 related to proline synthesis. D：Expressions of BADH related to betaine synthesis

Fig. 6 ROS scavenging capacity assay of seedlings regul-ated by AtSCL4 under osmotic stress A：Observation of H2O2 content by DAB staining. B：Observation of O2-· content by NBT staining. C：SOD activities. D：POD activities. E：Expression of AtSOD1.F：Expression of PER4

References 24

[1]	Wang J, Song L, Gong X, et al. Functions of jasmonic acid in plant regulation and response to abiotic stress[J]. Int J Mol Sci, 2020, 21(4):1446. doi: 10.3390/ijms21041446 URL
[2]	Rabbani MA, Maruyama K, Abe H, et al. Monitoring expression profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid application using cDNA microarray and RNA gel-blot analyses[J]. Plant Physiol, 2003, 133(4):1755-1767. pmid: 14645724
[3]	Hsieh EJ, Cheng MC, Lin TP. Functional characterization of an abiotic stress-inducible transcription factor AtERF53 in Arabidopsis thaliana[J]. Plant Mol Biol, 2013, 82(3):223-237. doi: 10.1007/s11103-013-0054-z URL
[4]	Sakuraba Y, Kim YS, Han SH, et al. The Arabidopsis transcription factor NAC016 promotes drought stress responses by repressing AREB1 transcription through a trifurcate feed-forward regulatory loop involving NAP[J]. Plant Cell, 2015, 27(6):1771-1787. doi: 10.1105/tpc.15.00222 URL
[5]	Bolle C. The role of GRAS proteins in plant signal transduction and development[J]. Planta, 2004, 218(5):683-692. doi: 10.1007/s00425-004-1203-z URL
[6]	Sun X, Xue B, Jones WT, et al. A functionally required unfoldome from the plant kingdom:intrinsically disordered N-terminal domains of GRAS proteins are involved in molecular recognition during plant development[J]. Plant Mol Biol, 2011, 77(3):205-223. doi: 10.1007/s11103-011-9803-z URL
[7]	Liu X, Widmer A. Genome-wide comparative analysis of the GRAS gene family in Populus, Arabidopsis and rice[J]. Plant Mol Biol Report, 2014, 32(6):1129-1145. doi: 10.1007/s11105-014-0721-5 URL
[8]	Chen YQ, Tai SS, Wang DW, et al. Homology-based analysis of the GRAS gene family in tobacco[J]. Genet Mol Res, 2015, 14(4):15188-15200. doi: 10.4238/2015.November.25.7 pmid: 26634482
[9]	Lu J, Wang T, Xu Z, et al. Genome-wide analysis of the GRAS gene family in Prunus mume[J]. Mol Genet Genomics, 2015, 290(1):303-317. doi: 10.1007/s00438-014-0918-1 URL
[10]	Song XM, Liu TK, Duan WK, et al. Genome-wide analysis of the GRAS gene family in Chinese cabbage(Brassica rapa ssp. pekinensis)[J]. Genomics, 2014, 103(1):135-146. doi: 10.1016/j.ygeno.2013.12.004 URL
[11]	Huang W, Xian Z, Kang X, et al. Genome-wide identification, phylogeny and expression analysis of GRAS gene family in tomato[J]. BMC Plant Biol, 2015, 15:209. doi: 10.1186/s12870-015-0590-6 pmid: 26302743
[12]	Wang Y, Shi S, Zhou Y, et al. Genome-wide identification and characterization of GRAS transcription factors in sacred Lotus(Nelumbo nucifera)[J]. PeerJ, 2016, 4:e2388.
[13]	Xu K, Chen SJ, Li TF, et al. OsGRAS23, a rice GRAS transcription factor gene, is involved in drought stress response through regulating expression of stress-responsive genes[J]. BMC Plant Biol, 2015, 15:141. doi: 10.1186/s12870-015-0532-3 URL
[14]	Yuan YY, Fang LC, Karungo SK, et al. Overexpression of VaPAT1, a GRAS transcription factor from Vitis amurensis, confers abiotic stress tolerance in Arabidopsis[J]. Plant Cell Rep, 2016, 35(3):655-666. doi: 10.1007/s00299-015-1910-x URL
[15]	Ma HS, Liang D, Shuai P, et al. The salt- and drought-inducible poplar GRAS protein SCL7 confers salt and drought tolerance in Arabidopsis thaliana[J]. J Exp Bot, 2010, 61(14):4011-4019. doi: 10.1093/jxb/erq217 URL
[16]	Zhang S, Li XW, de Fan S, et al. Overexpression of HcSCL13, a Halostachys caspica GRAS transcription factor, enhances plant growth and salt stress tolerance in transgenic Arabidopsis[J]. Plant Physiol Biochem, 2020, 151:243-254. doi: 10.1016/j.plaphy.2020.03.020 URL
[17]	Zhang Y, Zhou YY, Zhang D, et al. PtrWRKY75 overexpression reduces stomatal aperture and improves drought tolerance by salicylic acid-induced reactive oxygen species accumulation in poplar[J]. Environ Exp Bot, 2020, 176:104117.
[18]	Liang YK, Dubos C, Dodd IC, et al. AtMYB₆1, an R2R3-MYB transcription factor controlling stomatal aperture in Arabidopsis thaliana[J]. Curr Biol, 2005, 15(13):1201-1206. doi: 10.1016/j.cub.2005.06.041 URL
[19]	Miller G, Suzuki N, Ciftci-Yilmaz S, et al. Reactive oxygen species homeostasis and signalling during drought and salinity stresses[J]. Plant Cell Environ, 2010, 33(4):453-467. doi: 10.1111/j.1365-3040.2009.02041.x URL
[20]	Ashraf M, Foolad MR. Roles of Glycine betaine and proline in improving plant abiotic stress resistance[J]. Environ Exp Bot, 2007, 59(2):206-216. doi: 10.1016/j.envexpbot.2005.12.006 URL
[21]	Silva-Ortega CO, Ochoa-Alfaro AE, Reyes-Agüero JA, et al. Salt stress increases the expression of p5cs gene and induces proline accumulation in Cactus pear[J]. Plant Physiol Biochem, 2008, 46(1):82-92. doi: 10.1016/j.plaphy.2007.10.011 URL
[22]	Ishitani M, Arakawa K, Mizuno K, et al. Betaine aldehyde dehydrogenase in the Gramineae:levels in leaves both betaine-accumulating and nonaccumulating cereal plants[J]. Plant Cell Physiol, 1993, 34(3):493-495.
[23]	Petrov V, Hille J, Mueller-Roeber B, et al. ROS-mediated abiotic stress-induced programmed cell death in plants[J]. Front Plant Sci, 2015, 6:69.
[24]	Wang L, Li Z, Lu M, et al. ThNAC13, a NAC transcription factor from Tamarix hispida, confers salt and osmotic stress tolerance to transgenic Tamarix and Arabidopsis[J]. Front Plant Sci, 2017, 8:635. doi: 10.3389/fpls.2017.00635 URL