Alternative Translation of Wheat Enolase-encoding Gene ENO2 and Its Prokaryotic Expression

doi:10.13560/j.cnki.biotech.bull.1985.2023-1223

Abstract

Abstract:

【Objective】The objective of this study is to identify the genes（TaENO2s）encoding the enolase family member ENO2 in the important crop plant of wheat（Triticum aestivum L.）and to determine the alternative translation feature and protein enolase activity of TaENO2s.【Method】Wheat TaENO2s were identified by bioinformatics. One of the identified TaENO2s was selected as a representative for protoplast-based exogenous expression and characterization of alternative translation products. This selected TaENO2 was also subjected to prokaryotic expression for purification of recombinant protein. The enolase activity of the purified recombinant protein was determined with in vitro assays. 【Result】The hexaploid wheat genome had three homeologous TaENO2s which sequences encoded a conserved enolase catalytic center and had a putative alternative translation start site at the internal ATG codon encoding the residue M94（ATG^M94）of the enolase sequence. When exogenously expressed in protoplasts, the representative TaENO2 encoded two proteins, one full-length form of cytoplasmic and nuclear enolase protein and one N-terminal truncated form of nuclear transcriptional repressor TaMBP-1, while the variant of the same gene containing mutated ATG^M94only encoded the full-length form of enolase protein. Soluble recombinant GST-TaENO2 protein expressed in Escherichia coli was successfully purified and verified to have an in vitro enzymatic activity to catalyze the conversion from 2-phosphoglycerate（2-PGA）to phosphoenolpyruvate（PEP）. 【Conclusion】The wheat genome has three TaENO2 genes encoding the enolase protein ENO2. Under the condition of exogenous expression, TaENO2 encodes two protein products via mRNA alternative translation, one enolase protein translated from the first start codon and one TaMBP-1 protein translated from the internal start codon ATG^M94. The prokaryotically expressed recombinant protein GST-TaENO2 possesses in vitro enolase activity.

Key words: wheat, enolase, ENO2, alternative translation, prokaryotic expression

ZHANG Na, LIU Meng-nan, QU Zhan-fan, CUI Yi-ping, NI Jia-yao, WANG Hua-zhong. Alternative Translation of Wheat Enolase-encoding Gene ENO2 and Its Prokaryotic Expression[J]. Biotechnology Bulletin, 2024, 40(5): 112-119.

Figures/Tables 5

Table 1 Primers used in this study

引物名称 Prime name	引物序列 Primer sequence（5'-3'）
ENO-m-F	AAGTCCGGAGCTAGCTATGGCGGCGACGATCCAGTC
ENO-m-R	GCCCTTGCTCACCATGGCGTATGGCTCCACCGGTGCAC
Δ93-m-F	AAGTCCGGAGCTAGCTATGGTTCAGCAGCTTGATGGA
Δ93-m-R	GCCCTTGCTCACCATGGCGTATGGCTCCACCGGTGCAC
M94A-F1	AAGTCCGGAGCTAGCTATGGCGGCGACGATCCAGTC
M94A-R1	AACAGCAAAGTTGTCGAGCTCAGTTTGAG
M94A-F2	GCTCGACAACTTTGCTGTTCAGCAGCTTGATGGAACCAAG
M94A-R2	GCCCTTGCTCACCATGGCGTATGGCTCCACCGGTGCAC
ENO-GST-F	GATCTGGTTCCGCGTGGATCCATGGCGGCGACGATCCAGTC
ENO-GST-R	GTCACGATGCGGCCGCTCGAGGTATGGCTCCACCGGTGCAC

Fig. 1 Protein sequence alignment of wheat and Arabidopsis enolases TaENO2-5A, TaENO2-5B, and TaENO2-5D are wheat enolases of homeologous ENO2 proteins, and AtENO1, AtENO2, and AtENO3 are Arabidopsis enolase proteins. Solid red box indicates the serine residue（S）responsible for binding of Mg2+ in the catalytic center. Dashed red box indicates the second methionine residue（M）in the ENO2 sequences. The ATG codon encoding this residue is an internal start codon of alternative translation

Fig. 2 Alternative translation products of TaENO2 A: Schematic representation of the three forms（I, II, and III）of mCherry-fused TaENO2 coding sequences. B: Subcellular localization of the alternative translation products of TaENO2. Different mCherry fusion genes shown in（A）were respectively transformed into protoplasts for expression. The subcellular distribution of red fluorescence and the Hoechst 33342-stained nuclei in protoplasts were observed at 24 h after protoplast transformation. Scale bar indicates 10 μm. C: Western blot analysis on the alternative translation products of TaENO2 expressed in protoplasts

Fig. 3 Prokaryotic expression and purification of recombinant GST-TaENO2 protein A: Prokaryotic expression of recombinant GST-TaENO2 protein. The E. coli strain BL21（DE3）carrying the fusion gene GST-TaENO2 was grown to the log growth phase. The heterologous protein expression was then induced with IPTG for the indicated time periods. Cells were lysed by boiling and an equal aliquot of protein was resolved by SDS-PAGE. Arrows indicate the bands of recombinant protein. B: Solubility analysis on the prokaryotically expressed recombinant GST-TaENO2 protein. E. coli culture induced by IPTG was lysed by sonication. The soluble and insoluble protein fractions were separated by centrifugation and resolved by SDS-PAGE. Arrows indicate the bands of recombinant protein GST-TaENO2. C: Purification of recombinant GST-TaENO2 protein. M: Protein marker; 1: Total extracted protein from the E. coli culture which was not subjected to IPTG induction of gene expression; 2: Total extracted protein from the E.coli culture which had been subjected to IPTG induction of gene expression for 4 h; 3-6: Collected flow-through（3）and successive elution fractions（4-6）in the process of protein purification by affinity chromatography. D: Western blot analysis of the purified recombinant GST-TaENO2 protein. Arrows indicate the bands of recombinant protein

Fig. 4 In vitro assays on the enolase activity of the recombinant protein GST-TaENO2 The catalytic product of enolase, PEP, has maximum optical absorption at a wavelength of 230 nm. The figure shows the time-dependent changes in the optical density of the in vitro enolase assay solutions at 230 nm（OD230）. Red dash box indicates the near linear increase stage of OD230. The data of this stage were used for calculation of enolase activity

References 19

[1]	Andriotis VME, Kruger NJ, et al. Plastidial glycolysis in developing Arabidopsis embryos[J]. New Phytol, 2010, 185(3): 649-662. doi: 10.1111/j.1469-8137.2009.03113.x pmid: 20002588
[2]	Lee H, Guo Y, Ohta M, et al. LOS2, a genetic locus required for cold-responsive gene transcription encodes a bi-functional enolase[J]. EMBO J, 2002, 21(11): 2692-2702. doi: 10.1093/emboj/21.11.2692 pmid: 12032082
[3]	Voll LM, Hajirezaei MR, Czogalla-Peter C, et al. Antisense inhibition of enolase strongly limits the metabolism of aromatic amino acids, but has only minor effects on respiration in leaves of transgenic tobacco plants[J]. New Phytol, 2009, 184(3): 607-618. doi: 10.1111/j.1469-8137.2009.02998.x pmid: 19694966
[4]	Troncoso-Ponce MA, Rivoal J, Dorion S, et al. Molecular and biochemical characterization of the sunflower(Helianthus annuus L.) cytosolic and plastidial enolases in relation to seed development[J]. Plant Sci, 2018, 272: 117-130. doi: S0168-9452(18)30173-0 pmid: 29807582
[5]	Qiao G, Wu AG, Chen XL, et al. Enolase 1, a moonlighting protein, as a potential target for cancer treatment[J]. Int J Biol Sci, 2021, 17(14): 3981-3992. doi: 10.7150/ijbs.63556 pmid: 34671213
[6]	Liu WC, Song RF, Qiu YM, et al. Sulfenylation of ENOLASE2 facilitates H₂O₂-conferred freezing tolerance in Arabidopsis[J]. Dev Cell, 2022, 57(15): 1883-1898.e5.
[7]	Barkla BJ, Vera-Estrella R, et al. Quantitative proteomics of the tonoplast reveals a role for glycolytic enzymes in salt tolerance[J]. Plant Cell, 2009, 21(12): 4044-4058.
[8]	Liu ZJ, Zheng LM, Pu L, et al. ENO2 affects the seed size and weight by adjusting cytokinin content and forming ENO2-bZIP75 complex in Arabidopsis thaliana[J]. Front Plant Sci, 2020, 11: 574316.
[9]	Liu ZJ, Liu HM, Zheng LM, et al. Enolase2 regulates seed fatty acid accumulation via mediating carbon partitioning in Arabidopsis thaliana[J]. Physiol Plant, 2022, 174(6): e13797.
[10]	Zhang YJ, Sampathkumar A, Kerber SML, et al. A moonlighting role for enzymes of glycolysis in the co-localization of mitochondria and chloroplasts[J]. Nat Commun, 2020, 11(1): 4509. doi: 10.1038/s41467-020-18234-w pmid: 32908151
[11]	Eremina M, Rozhon W, et al. ENO2 activity is required for the development and reproductive success of plants, and is feedback-repressed by AtMBP-1[J]. Plant J, 2015, 81(6): 895-906.
[12]	Liu ZJ, Zhang YH, Ma XF, et al. Biological functions of Arabidopsis thaliana MBP-1-like protein encoded by ENO2 in the response to drought and salt stresses[J]. Physiol Plant, 2020, 168(3): 660-674.
[13]	Yang LY, Wang ZX, Zhang AQ, et al. Reduction of the canonical function of a glycolytic enzyme enolase triggers immune responses that further affect metabolism and growth in Arabidopsis[J]. Plant Cell, 2022, 34(5): 1745-1767.
[14]	Ma XF, Wu Y, Ming HN, et al. AtENO2 functions in the development of male gametophytes in Arabidopsis thaliana[J]. J Plant Physiol, 2021, 263: 153417.
[15]	Bi CX, Yu YH, Dong CH, et al. The bZIP transcription factor TabZIP15 improves salt stress tolerance in wheat[J]. Plant Biotechnol J, 2021, 19(2): 209-211.
[16]	Zhang YF, Wang JY, et al. Wheat TaSnRK2.10 phosphorylates TaERD15 and TaENO1 and confers drought tolerance when overexpressed in rice[J]. Plant Physiol, 2023, 191(2): 1344-1364.
[17]	Liu ZJ, Zhang A, Zheng LM, et al. The biological significance and regulatory mechanism of c-myc binding protein 1(MBP-1)[J]. Int J Mol Sci, 2018, 19(12): 3868.
[18]	Kang M, Abdelmageed H, Lee S, et al. AtMBP-1, an alternative translation product of LOS2, affects abscisic acid responses and is modulated by the E3 ubiquitin ligase AtSAP5[J]. Plant J, 2013, 76(3): 481-493.
[19]	杜晓敏, 王均, 等. 小麦叶肉细胞原生质体制备参数解析及在基因瞬时表达上的应用[J]. 华北农学报, 2015, 30(6): 52-60. doi: 10.7668/hbnxb.2015.06.008
	Du XM, Wang J, et al. Factors influencing the preparation of wheat mesophyll protoplasts and the application of wheat mesophyll protoplasts in gene transient expression[J]. Acta Agric Boreali Sin, 2015, 30(6): 52-60.