Establishment of Porcine Fetal Fibroblasts with OXTR-knockout Using CRISPR/Cas9

doi:10.13560/j.cnki.biotech.bull.1985.2021-1432

Abstract

Abstract:

This work is aimed to construct OXTR（oxytocin receptor）- knocked porcine fetal fibroblasts（PFFs）via CRISPR/Cas9,which could be used as donor cells to generate OXTR disrupted Bama miniature pig models. Firstly,the pig OXTR and its human counterpart were analyzed by bioinformatics. Next,two sgRNAs targeting the exon region of pig OXTR were designed using online tools（http://www.rgenome.net/cas-offinder/）and ligated into the pX330 plasmid. Finally,the gene targeting plasmids were co-transfected with a neomycin-expression plasmid into early passage of primary PFFs. G418 screening was used to obtain the resistant single-cell colonies,and the Sanger sequencing was used to determine their genotypes. Bioinformatics analysis showed that the OXTR genes of humans and pigs had a close evolutionary distance. The identity and similarity of the amino acid sequence of human and pig OXTR were 91% and 93%,respectively. The RMSD value of the three-dimensional structure was 0.009. The Cas9/sgRNA targeting vectors of gene OXTR were constructed successfully. After the transfection of PFFs cells,drug screening was used to obtain OXTR knockout monoclonal cells,and they were sequenced,as well as the gene mutant type was confirmed. In conclusion,the human and porcine OXTR are evolutionarily conserved and highly homologous. The constructed Cas9/sgRNA expression vector may allow the OXTR gene editing achieved. The OXTR-knocked monoclonal cells were successfully obtained,which paves the early foundation for the generation of OXTR-knocked Bama pig model.

Key words: CRISPR/Cas9, OXTR gene, bioinformatics analysis, porcine fetal fibroblasts

LIU Jing-jing, LIU Xiao-rui, LI Lin, WANG Ying, YANG Hai-yuan, DAI Yi-fan. Establishment of Porcine Fetal Fibroblasts with OXTR-knockout Using CRISPR/Cas9[J]. Biotechnology Bulletin, 2022, 38(6): 272-278.

Figures/Tables 8

Table 1 Amplification primers for exon 2 sequene of OXTR gene

名称 Primer name	引物序列 Primer sequence（5'-3'）	产物大小 Fragment length
OXTR-F	ACCTGCCCAAGAAGTCTCAG	748 bp
OXTR-R	CAGCAGCAGGTAAGTGGAAG	748 bp

Fig.1 Phylogenetic tree of OXTR sequences of different species

Fig.2 Analysis of primary,secondary,and tertiary structures of OXTR between humans and pigs A：Amino acid sequence homology analysis of human and pig OXTR,and the identical amino acids are blue shaded. B：Secondary structures of human and pig proteins. Red indicates alpha-helix;green indicates beta-sheet;and blue indicates beta-turn. C：Tertiary structures of human and pig proteins. Red indicates the structure of human OXTR,and green indicates the structure of pig OXTR

Fig. 3 Identification of domains and key residues of porcine OXTR A：Schematic diagram of domains and catalytic residues of pig OXTR. B：Multiple sequence alignment of OXTR,＃ denotes critical amino acid residues binding to ligand

Fig.4 Target of OXTR gene and sequencing of recombinant vectors A：Schematic diagram of OXTR gene target in Bama miniature pig. Gray indicates the non-coding area and black indicates the coding areas. B：Schematic diagram of pX330 vector. C and D：Sequencing map of recombinant vector. Black underlined is the insertion sequence

Table 2 Oligonucleotide sequences of sgRNAs at OXTR targeting sites

sgRNA	序列Sequence（5'-3'）
sgRNA-1-F	CACCGGTGCTGCCTCAGCTACTGT
sgRNA-1-R	AAACACAGTAGCTGAGGCAGCACC
sgRNA-2-F	CACCGAACTTGCGGCTCAAGACTG
sgRNA-2-R	AAACCAGTCTTGAGCCGCAAGTTC

Fig.5 Sequencing results of OXTR-knockout PFFs

Table 3 Genotypes of OXTR-knockout PFFs

编号 ID name	目的片段 Target fragment	突变型 Indels
WT	CAGGTGCTGCCTCAGCTACTGTGGG//GGCAGAACTTGCGGCTCAAGACTGCG	WT
1	CAGGTGCTGCCTCAGCTAC-----// ----------------------CTGCGG	-411 bp
2	CAGGTGCTGCCTCAGCTAC-----// ----------------------CTGCGG	-411 bp
3	CAGGTGCTGCCTCAGCTAC-----// ----------------------CTGCGG	-411 bp
4	CAGGTGCTGCCTCAGCTACTG---// -------------------------CGG	-412 bp
5	CAGGTGCTGCCTCAGCTACTCTTGA//AGCGGAAGGTGATATCCCACACTGCGG	-289,+289 bp

References 25

[1]	Park HR, Lee JM, Moon HE, et al. A short review on the current understanding of autism spectrum disorders[J]. Exp Neurobiol, 2016, 25(1):1-13. doi: 10.5607/en.2016.25.1.1 pmid: 26924928
[2]	Feldman R, Monakhov M, Pratt M, et al. Oxytocin pathway genes:evolutionary ancient system impacting on human affiliation, sociality, and psychopathology[J]. Biol Psychiatry, 2016, 79(3):174-184. doi: 10.1016/j.biopsych.2015.08.008 URL
[3]	Tops S, Habel U, Radke S. Genetic and epigenetic regulatory mechanisms of the oxytocin receptor gene(OXTR)and the(clinical)implications for social behavior[J]. Horm Behav, 2019, 108:84-93. doi: 10.1016/j.yhbeh.2018.03.002 URL
[4]	Jurek B, Neumann ID. The oxytocin receptor:from intracellular signaling to behavior[J]. Physiol Rev, 2018, 98(3):1805-1908. doi: 10.1152/physrev.00031.2017 URL
[5]	Vaidyanathan R, Hammock EAD. Oxytocin receptor gene loss influences expression of the oxytocin gene in C57BL/6J mice in a sex- and age-dependent manner[J]. J Neuroendocrinol, 2020, 32(2):e12821.
[6]	Haram M, Bettella F, Brandt CL, et al. Contribution of oxytocin receptor polymorphisms to amygdala activation in schizophrenia spectrum disorders[J]. BJPsych Open, 2016, 2(6):353-358. doi: 10.1192/bjpo.bp.116.003376 URL
[7]	Uzefovsky F, Bethlehem RAI, Shamay-Tsoory S, et al. The oxytocin receptor gene predicts brain activity during an emotion recognition task in autism[J]. Mol Autism, 2019, 10:12. doi: 10.1186/s13229-019-0258-4 pmid: 30918622
[8]	Caria A, Ciringione L, Falco S. Morphofunctional alterations of the hypothalamus and social behavior in autism spectrum disorders[J]. Brain Sci, 2020, 10(7):435. doi: 10.3390/brainsci10070435 URL
[9]	Pobbe RLH, Pearson BL, Defensor EB, et al. Oxytocin receptor knockout mice display deficits in the expression of autism-related behaviors[J]. Horm Behav, 2012, 61(3):436-444. doi: 10.1016/j.yhbeh.2011.10.010 URL
[10]	Ribeiro D, Nunes AR, Gliksberg M, et al. Oxytocin receptor signalling modulates novelty recognition but not social preference in zebrafish[J]. J Neuroendocrinol, 2020, 32(4):e12834.
[11]	Chang SWC, Brent LJN, Adams GK, et al. Neuroethology of primate social behavior[J]. Proc Natl Acad Sci USA, 2013, 110(Suppl 2):10387-10394. doi: 10.1073/pnas.1301213110 URL
[12]	Ma YL, Wei JL, Zhang Q, et al. A genome scan for selection signatures in pigs[J]. PLoS One, 2015, 10(3):e0116850.
[13]	Li MZ, Chen L, Tian SL, et al. Comprehensive variation discovery and recovery of missing sequence in the pig genome using multiple de novo assemblies[J]. Genome Res, 2017, 27(5):865-874. doi: 10.1101/gr.207456.116 URL
[14]	Zhang JF, Khazalwa EM, Abkallo HM, et al. The advancements, challenges, and future implications of the CRISPR/Cas9 system in swine research[J]. J Genet Genomics, 2021, 48(5):347-360. doi: 10.1016/j.jgg.2021.03.015 URL
[15]	Sauleau P, Lapouble E, Val-Laillet D, et al. The pig model in brain imaging and neurosurgery[J]. Animal, 2009, 3(8):1138-1151. doi: 10.1017/S1751731109004649 pmid: 22444844
[16]	Gao MY, Zhu XL, Yang G, et al. CRISPR/Cas9-mediated gene editing in porcine models for medical research[J]. DNA Cell Biol, 2021, 40(12):1462-1475. doi: 10.1089/dna.2020.6474 URL
[17]	Yang W, Chen X, Li S, et al. Genetically modified large animal models for investigating neurodegenerative diseases[J]. Cell Biosci, 2021, 11(1):218. doi: 10.1186/s13578-021-00729-8 URL
[18]	Gimpl G, Fahrenholz F. The oxytocin receptor system:structure, function, and regulation[J]. Physiol Rev, 2001, 81(2):629-683. pmid: 11274341
[19]	Tick B, Bolton P, Happé F, et al. Heritability of autism spectrum disorders:a meta-analysis of twin studies[J]. J Child Psychol Psychiatry, 2016, 57(5):585-595. doi: 10.1111/jcpp.12499 URL
[20]	Liu J, Nyholt DR, Magnussen P, et al. A genomewide screen for autism susceptibility loci[J]. Am J Hum Genet, 2001, 69(2):327-340. doi: 10.1086/321980 pmid: 11452361
[21]	Meyer-Lindenberg A, Tost H. Neural mechanisms of social risk for psychiatric disorders[J]. Nat Neurosci, 2012, 15(5):663-668. doi: 10.1038/nn.3083 pmid: 22504349
[22]	Cataldo I, Azhari A, Esposito G. A review of oxytocin and arginine-vasopressin receptors and their modulation of autism spectrum disorder[J]. Front Mol Neurosci, 2018, 11:27. doi: 10.3389/fnmol.2018.00027 pmid: 29487501
[23]	Li Z, Yang HY, Wang Y, et al. Generation of tryptophan hydroxylase 2 gene knockout pigs by CRISPR/Cas9-mediated gene targeting[J]. J Biomed Res, 2017, 31(5):445-452. doi: 10.7555/JBR.31.20170026 URL
[24]	Yao J, Zeng HS, Zhang M, et al. OSBPL2-disrupted pigs recapitulate dual features of human hearing loss and hypercholesterolaemia[J]. J Genet Genomics, 2019, 46(8):379-387. doi: 10.1016/j.jgg.2019.06.006 URL
[25]	Denes CE, Cole AJ, Aksoy YA, et al. Approaches to enhance precise CRISPR/Cas9-mediated genome editing[J]. Int J Mol Sci, 2021, 22(16):8571. doi: 10.3390/ijms22168571 URL