Genome-wide Identification and Expression Analysis of the SRO Gene Family in Brassica juncea L.

doi:10.13560/j.cnki.biotech.bull.1985.2024-0179

Abstract

Abstract:

【Objective】SRO gene family is a class of plant-specific transcription factors, which plays an important role in plant growth and development and stress response. The study of the SRO gene family in Brassica juncea L. provides a theoretical basis for analyzing the function of SRO genes in B. juncea L. and its genetic improvement.【Method】Bioinformatics was used to identify members of the SRO gene family in the genomes of two types of oilseed mustard and vegetable mustard, the software and database such as TBtools, MEGA, Cytoscape, NCBI, STRING, EggNOG were used for the analysis of physicochemical properties, sequence characterization, evolutionary relationships, regulatory networks, etc., as well as RT-qPCR to analyze the expression patterns under salt stress.【Result】There were differences in the number of members of the SRO gene family between the two types of B. juncea L., and they belonged to two major classes. Among them, class A SRO proteins contained WWE, PARP and RST structural domains, whereas class B proteins were lack of WWE domains. The promoter region of the SRO genes contained a variety of cis-acting elements for abiotic stress response and hormone response. The microRNA-BjuSRO-target genes constructed a complex regulatory network, which was involved in apoptosis, root morphogenesis, immune response, cellular response to heterologous stimuli, and response to reactive oxygen species, and other biological processes. The RT-qPCR results showed that BjuVA1a, BjuVA1e, BjuVA2a, BjuVA3a, BjuVB1b, and BjuVA2a were significantly upregulated under salt stress.【Conclusion】The SRO gene family in the mustard has functional diversity, and BjuVA1a, BjuVA1e, BjuVA2a, BjuVA3a, BjuVB1b, and BjuVA2a are closely related to the response to salt stress, which can be used as candidate genes for breeding new salt-tolerant varieties of B. juncea L.

Key words: Brassica juncea L., SRO transcription factors, bioinformatics, microRNA regulation, protein-protein interaction, GO enrichment analysis, phylogenetic analysis, gene expression analysis

YANG Wei, ZHAO Li-fen, TANG Bing, ZHOU Lin-bi, YANG Juan, MO Chuan-yuan, ZHANG Bao-hui, LI Fei, RUAN Song-lin, DENG Ying. Genome-wide Identification and Expression Analysis of the SRO Gene Family in Brassica juncea L.[J]. Biotechnology Bulletin, 2024, 40(8): 129-141.

Figures/Tables 10

Table 1 Primer sequences used in quantitative real-time PCR analysis of BjuSROs

基因名称Gene name	基因ID Gene ID	正向引物Forward primer（5'-3'）	反向引物Reverse primer（5'-3'）
BjuVA1a	BjuVA05G09830.1	CACTAAGTCACGCCGAGGAG	CTCTCCACCCACACCAAGTC
BjuVA1e	BjuVA09G34200.1	AAACATCGAGGGGACGCAAA	AATGCTCCCCCAACTCCAAG
BjuVA2a	BjuVB03G32070.1	ATGTAGGCCGCTTTTCCAGT	AACGTTTGCATCCCCTCGAT
BjuVA3a	BjuVA08G09520.1	ACCCAGGATCCTCAAGGTGT	CTCATCTTGCAGCTTTCCGC
BjuVA4a	BjuVB07G38920.1	GCGCTTATGAGACTCGCTCT	TCGCCCTCCTCGTAGATCAT
BjuVB1a	BjuVB03G28110.1	TCACAACGAGAGCCAAGCAT	AGCCAACGTACCAAGCGTAT
BjuVB1b	BjuVA07G14180.1	TCGATCCACTCTCCTCCTCC	GGAGAGGAAACACGTGGTGA
BjuVB2a	BjuVB04G02010.1	CGCCGTGGAGAAAACAGAGT	AGAGCATTATCCGGGGAGAGA
ACT7	NM_121018.4	GGAATCGCTGACCGTATGAG	ACCCTCCAATCCAGACACTG

Fig. 1 Structure analysis of BjuSRO gene A: Conserved motif analysis of BjuSRO protein. B: Structure analysis of BjuSRO gene. C: Conserved motif logo of BjuSRO protein

Fig. 2 Domain analysis of BjuSRO protein A: Schematic diagram of SRO protein classification. B: 3D structure diagram of representative BjuSRO protein. C: PARP domain sequence alignment of BjuSRO protein. D: WWE domain sequence alignment of class A BjuSRO protein. E: SRT domain sequence alignment of BjuSRO protein

Fig. 3 BjuSRO gene promoter-cis-acting element analysis

Fig. 4 Network diagram of interaction between Bju-miRNA and BjuSRO gene Diamonds indicate Bju-miRNAs; circles indicate BjuOSRO gene of oilseed mustard; octagon indicate BjuVSRO gene of vegetable mustard

Fig. 5 GO function enrichment analysis of BjuSRO gene

Fig. 6 Network diagram of BjuRSO protein interaction analysis Octagon indicate SRO proteins of vegetable mustard; triangle indicate other proteins

Fig. 7 Phylogenetic tree analysis of SRO gene family Circle indicates SRO proteins of Arabidopsis; pentagon indicate SRO proteins of oilseed mustard; triangle indicate SRO proteins of vegetable mustard

Fig. 8 Collinearity analysis of SRO gene A: Collinear analysis of BjuOSRO gene in oil mustard. B: Collinear analysis of BjuVSRO gene in vegetable mustard. Red line marks class A SRO gene, and green line marks class B SRO gene in Fig. A and B. C: Ka/Ks analysis of SRO homologous genes in mustard. D: Collinearity analysis of SRO gene between oil mustard and multi species（Bol: Cabbage; Bra: Chinese cabbage; Lag: loofah; Csa: cucumber; Sol: tomato; Sme: eggplant; Pvu: kidney beans; Phv: cowpea）

Fig. 9 Relative expressions of BjuSRO gene in mustard root system under salt stress at different times Different lowercase letters indicate significant differences（P<0.05）

References 47

[1]	Zhang HM, Zhu JH, Gong ZZ, et al. Abiotic stress responses in plants[J]. Nat Rev Genet, 2022, 23(2): 104-119.
[2]	Yang J, Ji LX, Liu S, et al. The CaM1-associated CCaMK-MKK1/6 cascade positively affects lateral root growth via auxin signaling under salt stress in rice[J]. J Exp Bot, 2021, 72(18): 6611-6627. doi: 10.1093/jxb/erab287 pmid: 34129028
[3]	Waadt R, Seller CA, Hsu PK, et al. Plant hormone regulation of abiotic stress responses[J]. Nat Rev Mol Cell Biol, 2022, 23(10): 680-694.
[4]	Chen H, Bullock DA Jr, Alonso JM, et al. To fight or to grow: the balancing role of ethylene in plant abiotic stress responses[J]. Plants, 2021, 11(1): 33.
[5]	Chini A, Monte I, Fernández-Barbero G, et al. A small molecule antagonizes jasmonic acid perception and auxin responses in vascular and nonvascular plants[J]. Plant Physiol, 2021, 187(3): 1399-1413. doi: 10.1093/plphys/kiab369 pmid: 34618088
[6]	Zhang LC, He GH, Li YP, et al. PIL transcription factors directly interact with SPLs and repress tillering/branching in plants[J]. New Phytol, 2022, 233(3): 1414-1425.
[7]	Cheng ZY, Luan YT, Meng JS, et al. WRKY transcription factor response to high-temperature stress[J]. Plants, 2021, 10(10): 2211.
[8]	Liu J, Meng QL, Xiang HT, et al. Genome-wide analysis of Dof transcription factors and their response to cold stress in rice(Oryza sativa L.)[J]. BMC Genomics, 2021, 22(1): 800.
[9]	Zhang HC, Shao SP, Zeng Y, et al. Reversible phase separation of HSF1 is required for an acute transcriptional response during heat shock[J]. Nat Cell Biol, 2022, 24(3): 340-352. doi: 10.1038/s41556-022-00846-7 pmid: 35256776
[10]	Verma S, Negi NP, Pareek S, et al. Auxin response factors in plant adaptation to drought and salinity stress[J]. Physiol Plant, 2022, 174(3): e13714.
[11]	Alshareef NO, Otterbach SL, Allu AD, et al. NAC transcription factors ATAF1 and ANAC055 affect the heat stress response in Arabidopsis[J]. Sci Rep, 2022, 12(1): 11264. doi: 10.1038/s41598-022-14429-x pmid: 35787631
[12]	Jaspers P, Overmyer K, Wrzaczek M, et al. The RST and PARP-like domain containing SRO protein family: analysis of protein structure, function and conservation in land plants[J]. BMC Genomics, 2010, 11: 170. doi: 10.1186/1471-2164-11-170 pmid: 20226034
[13]	Jaspers P, Blomster T, Brosché M, et al. Unequally redundant RCD1 and SRO1 mediate stress and developmental responses and interact with transcription factors[J]. Plant J, 2009, 60(2): 268-279.
[14]	Webb C, Upadhyay A, Giuntini F, et al. Structural features and ligand binding properties of tandem WW domains from YAP and TAZ, nuclear effectors of the Hippo pathway[J]. Biochemistry, 2011, 50(16): 3300-3309. doi: 10.1021/bi2001888 pmid: 21417403
[15]	Carter AA, Ramsey KM, Hatem CL, et al. Structural features of the Notch ankyrin domain-Deltex WWE2 domain heterodimer determined by NMR spectroscopy and functional implications[J]. Structure, 2023, 31(5): 584-594.e5.
[16]	Kim H, Aliar K, Tharmapalan P, et al. Differential DNA damage repair and PARP inhibitor vulnerability of the mammary epithelial lineages[J]. Cell Rep, 2023, 42(11): 113382.
[17]	Padella A, Ghelli Luserna Di Rorà A, Marconi G, et al. Targeting PARP proteins in acute leukemia: DNA damage response inhibition and therapeutic strategies[J]. J Hematol Oncol, 2022, 15(1): 10.
[18]	Maru B, Messikommer A, Huang LH, et al. PARP-1 improves leukemia outcomes by inducing parthanatos during chemotherapy[J]. Cell Rep Med, 2023, 4(9): 101191.
[19]	Kong L, Feng BM, Yan Y, et al. Noncanonical mono(ADP-ribosyl)ation of zinc finger SZF proteins counteracts ubiquitination for protein homeostasis in plant immunity[J]. Mol Cell, 2021, 81(22): 4591-4604.e8. doi: 10.1016/j.molcel.2021.09.006 pmid: 34592134
[20]	Vainonen JP, Jaspers P, Wrzaczek M, et al. RCD1-DREB2A interaction in leaf senescence and stress responses in Arabidopsis thaliana[J]. Biochem J, 2012, 442(3): 573-581. doi: 10.1042/BJ20111739 pmid: 22150398
[21]	Ahlfors R, Lång S, Overmyer K, et al. Arabidopsis radical-induced cell death1 belongs to the WWE protein-protein interaction domain protein family and modulates abscisic acid, ethylene, and methyl jasmonate responses[J]. Plant Cell, 2004, 16(7): 1925-1937. doi: 10.1105/tpc.021832 pmid: 15208394
[22]	Xu W, Zhu WW, Yang L, et al. SMALL REPRODUCTIVE ORGANS, a SUPERMAN-like transcription factor, regulates stamen and pistil growth in rice[J]. New Phytol, 2022, 233(4): 1701-1718.
[23]	You J, Zong W, Du H, et al. A special member of the rice SRO family, OsSRO1c, mediates responses to multiple abiotic stresses through interaction with various transcription factors[J]. Plant Mol Biol, 2014, 84(6): 693-705. doi: 10.1007/s11103-013-0163-8 pmid: 24337801
[24]	Li HH, Li R, Qu FJ, et al. Identification of the SRO gene family in apples(Malus × domestica)with a functional characterization of MdRCD1[J]. Tree Genet Genomes, 2017, 13(5): 94.
[25]	Yuan BQ, Chen MH, Li SS. Isolation and identification of Ipomoea cairica(L.)sweet gene IcSRO1 encoding a SIMILAR TO RCD-ONE protein, which improves salt and drought tolerance in transgenic Arabidopsis[J]. Int J Mol Sci, 2020, 21(3): 1017.
[26]	Du YJ, Roldan MVG, Haraghi A, et al. Spatially expressed WIP genes control Arabidopsis embryonic root development[J]. Nat Plants, 2022, 8(6): 635-645.
[27]	Li XY, Xu YJ, Liu F, et al. Maize similar to RCD1 gene induced by salt enhances Arabidopsis thaliana abiotic stress resistance[J]. Biochem Biophys Res Commun, 2018, 503(4): 2625-2632.
[28]	Sanlier N, Guler SM. The benefits of Brassica vegetables on human health[J]. Journal of Human Health Research, 2018, 1(1): 104.
[29]	Yang JH, Wang J, Li ZP, et al. Genomic signatures of vegetable and oilseed allopolyploid Brassica juncea and genetic loci controlling the accumulation of glucosinolates[J]. Plant Biotechnol J, 2021, 19(12): 2619-2628.
[30]	Chen CJ, Chen H, Zhang Y, et al. TBtools: an integrative toolkit developed for interactive analyses of big biological data[J]. Mol Plant, 2020, 13(8): 1194-1202. doi: S1674-2052(20)30187-8 pmid: 32585190
[31]	Islam S, Shah SH, Corpas FJ, et al. Plant growth regulators mediated mitigation of salt-induced toxicities in mustard(Brassica juncea L.)by modifying the inherent defense system[J]. Plant Physiol Biochem, 2023, 196: 1002-1018.
[32]	Dixit S, Jangid VK, Grover A. Evaluation of suitable reference genes in Brassica juncea and its wild relative Camelina sativa for RT-qPCR analysis under various stress conditions[J]. PLoS One, 2019, 14(9): e0222530.
[33]	Dizengremel P, Le Thiec D, Bagard M, et al. Ozone risk assessment for plants: central role of metabolism-dependent changes in reducing power[J]. Environ Pollut, 2008, 156(1): 11-15. doi: 10.1016/j.envpol.2007.12.024 pmid: 18243452
[34]	Li BZ, Zhao X, Zhao XL, et al. Structure and function analysis of Arabidopsis thaliana SRO protein family[J]. Yi Chuan, 2013, 35(10): 1189-1197.
[35]	Qiao YL, Gao XQ, Liu ZC, et al. Genome-wide identification and analysis of SRO gene family in Chinese cabbage(Brassica rapa L.)[J]. Plants, 2020, 9(9): 1235.
[36]	Vainonen JP, Shapiguzov A, Krasensky-Wrzaczek J, et al. Arabidopsis poly(ADP-ribose)-binding protein RCD1 interacts with photoregulatory protein kinases in nuclear bodies[J]. bioRxiv, 2020. https://doi.org/10.1101/2020.07.02.184937.
[37]	Hernandez-Garcia CM, Finer JJ. Identification and validation of promoters and cis-acting regulatory elements[J]. Plant Sci, 2014, 217/218: 109-119.
[38]	Lu TX, Rothenberg ME. MicroRNA[J]. J Allergy Clin Immunol, 2018, 141(4): 1202-1207. doi: S0091-6749(17)31593-2 pmid: 29074454
[39]	Saliminejad K, Khorram Khorshid HR, Soleymani Fard S, et al. An overview of microRNAs: biology, functions, therapeutics, and analysis methods[J]. J Cell Physiol, 2019, 234(5): 5451-5465. doi: 10.1002/jcp.27486 pmid: 30471116
[40]	Li N, Xu RQ, Wang BK, et al. Genome-wide identification and evolutionary analysis of the SRO gene family in tomato[J]. Front Genet, 2021, 12: 753638.
[41]	Zhang L, Zhou DB, Hu HG, et al. Genome-wide characterization of a SRO gene family involved in response to biotic and abiotic stresses in banana(Musa spp.)[J]. BMC Plant Biol, 2019, 19(1): 211. doi: 10.1186/s12870-019-1807-x pmid: 31113386
[42]	Jiang WQ, Geng YP, Liu YK, et al. Genome-wide identification and characterization of SRO gene family in wheat: molecular evolution and expression profiles during different stresses[J]. Plant Physiol Biochem, 2020, 154: 590-611.
[43]	Qin LM, Sun L, Wei L, et al. Maize SRO1e represses anthocyanin synthesis through regulating the MBW complex in response to abiotic stress[J]. Plant J, 2021, 105(4): 1010-1025.
[44]	Liu AL, Wei MY, Zhou Y, et al. Comprehensive analysis of SRO gene family in Sesamum indicum(L.)reveals its association with abiotic stress responses[J]. Int J Mol Sci, 2021, 22(23): 13048.
[45]	Song XW, Li Y, Cao XF, et al. MicroRNAs and their regulatory roles in plant-environment interactions[J]. Annu Rev Plant Biol, 2019, 70: 489-525. doi: 10.1146/annurev-arplant-050718-100334 pmid: 30848930
[46]	Singh I, Smita S, Mishra DC, et al. Abiotic stress responsive miRNA-target network and related markers(SNP, SSR)in Brassica juncea[J]. Front Plant Sci, 2017, 8: 1943.
[47]	Wang YT, Wang RQ, Yu Y, et al. Genome-wide analysis of SIMILAR TO RCD ONE(SRO)family revealed their roles in abiotic stress in poplar[J]. Int J Mol Sci, 2023, 24(4): 4146.