Loading...

Table of Content

    26 June 2020, Volume 36 Issue 6
    Dynamic Control:An Efficient Strategy for Metabolically Engineering Microbial Cell Factories
    YE Jian-wen, CHEN Jiang-nan, ZHANG Xu, Wu Fu-qing, CHEN Guo-qiang
    2020, 36(6):  1-12.  doi:10.13560/j.cnki.biotech.bull.1985.2020-0317
    Asbtract ( 1273 )   HTML   PDF (3768KB) ( 3294 )  
    References | Related Articles | Metrics
    Dynamic control,consisting of 3 parts of input signal generator,biosensor and actuator,is one of the most efficient strategies for metabolic engineering optimization. The input signals can be metabolites and environmental changes,such as chemicals,RNA,temperature,light,etc. Biosensors are input signal-responsive genetic parts that transfer signals into specific ones that actuate the expression of target genes or can be used as input of downstream cascaded sensor systems. Here,we briefly introduce the basic principles and categories of dynamic control systems,and review the cases of microbial cell factory engineering by employing dynamic control,mainly including the advantages,recent progresses,construction and characterization. Meanwhile,we also discuss the potential opportunities and challenges of employing dynamic control in metabolically engineering microbial cell factories.
    Tolerance Elements and Their Application Progress on the Construction of Highly-efficient Microbial Cell Factory
    CHANG Han-wen, ZHENG Xin-ling, LUO Jian-mei, WANG Min, SHEN Yan-bing
    2020, 36(6):  13-34.  doi:10.13560/j.cnki.biotech.bull.1985.2020-0259
    Asbtract ( 962 )   HTML   PDF (1995KB) ( 644 )  
    References | Related Articles | Metrics
    Microorganisms,acting as cell factory,often encounter various stresses during the application process,which severely restrict cell viability and production performance. It is widely accepted that cell stress tolerance is a complex phenotype controlled by multiple intracellular metabolic pathways and diverse physiological systems. Therefore,the exploration and application for tolerance elements that endow strains with higher stress tolerance are an effective approach to construct highly-efficient microbial cell factory. At present,the reported tolerance elements mainly include the related genes that regulate cell wall and cell membrane,DNA repair,oxidative responses to stress,compatible solutes,energy generation and signal transduction as well as efflux pumps,heat shock proteins and global transcriptional factors. In this paper,tolerance elements and their application cases on the construction of highly-efficient microbial cell factory are reviewed. Meanwhile,the opportunities and challenges in practice are discussed.
    Preliminary Study on Interaction Between Arabidopsis thaliana EBP1 Protein and RNA
    LI Xiao-yan, LI Chi-yu, YU Feng, LIAO Hong-dong
    2020, 36(6):  35-45.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1066
    Asbtract ( 720 )   HTML   PDF (6188KB) ( 692 )  
    References | Related Articles | Metrics
    Gene expression regulation is a hot spot in modern molecular biology,and the post-transcriptional regulation of RNA has attracted great concerns of researchers with the development of technology. RNA binding proteins(RBPs),as an important post-transcriptional regulator,are involved in RNA alternative splicing,RNA stability,translation,and so on. ErbB3 binding protein(EBP1)is an RBP with highly conserved structure and functions,and is involved in the regulation of ribosome biogenesis and protein translation through binding a variety of RNAs such as rRNA,tRNA,and mRNA. However,few of RNA targets of EBP1 have been documented and the mechanism of interaction with its RNA target is still unknown. Here,the conserved RNA-binding domain in Arabidopsis EBP1 was predicted through bioinformatics analysis. “GUCUCUCACUGCGACGGCUU” sequence was directly bound by EBP1 in vitro. Further,mRNAs of three genes(AT1G24792,AT3G25211 and AT3G24320)were identified in RNA immunoprecipitation assay. Polysome profiling and cordycepin treatment experiments demonstrated that EBP1 significantly regulated the stability of these target mRNAs and their translation rates. Our results confirm that Arabidopsis EBP1 has the function of binding RNA,and regulates the post-transcriptional events of target RNAs,which provides useful data for further studying the biological mechanism of EBP1 post-transcriptional regulation.
    Overexpression of Grape ERECTA Enhances Growth and Thermo-tolerance of Arabidopsis
    LIU Min, FANG Yu-lin
    2020, 36(6):  46-53.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1170
    Asbtract ( 720 )   HTML   PDF (4242KB) ( 702 )  
    References | Related Articles | Metrics
    ERECTA gene expression in grape is induced by high temperature,and its expression level is high in young leaves and flowers. In order to study the role of grape ERECTA gene in plant growth/development and the response to high temperature,this gene was overexpressed in Arabidopsis,and its phenotype and thermo-tolerance were observed. The results showed that in the ERECTA-overexpressed Arabidopsis,the length,width and number of leaves increased,the pedicel became elongated,and pod length and plant height also increased significantly. Arabidopsis seeds were cultured at room temperature for 2 d after heat treatment. It was found that most Landsberg erecta(Ler)seedlings did not develop normally,while overexpressed seedlings ER-OE were not affected by heat stress. After Arabidopsis plants were treated at 40℃ for 4 d,ER-OE plants were subjected to little heat damage. The electrolyte leakage of leaves was Ler>Col>ER-OE. After recovery at 22℃for 5 d,the survival rate of Col,Ler and ER-OE was 33%,12% and 83%,respectively. ERECTA can not only improve the heat resistance of plants,but also increase the growth amount,which provides a new genetic resource for breeding new resistant varieties of grape,and has a promising application prospect in agricultural production.
    Cloning and Functional Analysis of a Wheat Pathogenesis-Related Gene TaSec14
    NIU Huan, FENG Jing-yun, HUANG Jian-guo, ZHANG Chao-qun, ZHANG Lu-lu, LIU Xiao-ying, WANG Zhen-ying
    2020, 36(6):  54-62.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1043
    Asbtract ( 630 )   HTML   PDF (4390KB) ( 725 )  
    References | Related Articles | Metrics
    The Sec14 protein family in plants is involved in essential life processes such as phosphate metabolism and signal transduction. A phosphatidylinositol transporter gene was cloned from the powdery mildew-susceptible wheat cultivar Jing411. The length of open reading frame is 1 212 bp,encoding 403 amino acids. It contains a conserved SEC14 domain and has 80.45% homology with the phosphatidylinositol transporter PITP3(XP_010236107.1)in Brachypodium distachyon,designated as TaSec14. After inoculation with Blumeria graminis f. sp. tritici(Bgt)isolate,the expression of TaSec14 in Jing411 and its near isogenic line BJ-1 was consistent and higher than that in Brock. After knocking down the TaSec14 gene in Jing411 by virus-mediated gene silencing(VIGS),the successful infection rate of the Bgt conidiaspores in the BSMV∶TaSec14 experimental group was lower than that in the GKP Buffer control group,and the deformity rate was higher than that of the control group. The above results indicated that reducing the expression of TaSec14 gene to some extent increased the resistance of susceptible wheat Jing411 to powdery mildew. It is speculated that TaSec14 gene may play a regulatory role in the interaction between wheat and powdery mildew.
    Effects of Exogenous Melatonine on the Physiological Characteristics of Peony Seedlings Under Drought Stress
    FAN Hai-xia, ZHAO Sa, XIN Guo-qi, LI Jing
    2020, 36(6):  63-72.  doi:10.13560/j.cnki.biotech.bull.1985.2020-0055
    Asbtract ( 679 )   HTML   PDF (2898KB) ( 2031 )  
    References | Related Articles | Metrics
    To further explore the effects of exogenous melatonine(MT)in strengthening the ability of peony seedlings resisting drought and its physiological mechanisms,Paeonia ostii(Fengdan)seedlings were selected to study the effects of different concentrations(50,100,and 200 μmol/L)of exogenous MT on their growth and physiological characteristics under drought stress. The results showed that the growth and photosynthesis of the peony seedlings were significantly inhibited under drought stress,and lipid peroxidation and injury index of leaf cells increased,leading to oxidative stress and osmotic response. The damages caused by drought stress on the peony seedlings treated with the exogenous MT were alleviated,and specifically demonstrated as the mass of roots,stems,leaves and total dry matter increased,the degradation of photosynthetic pigments such as chlorophyll a,chlorophyll b and carotenoids reduced,and photosynthesis and PSⅡelectron transport ability improved,MDA,H2O2,O2- content and cell membrane damage index reduced,the activity of antioxidant enzymes such as SOD,CAT,APX and GR increased to reduce lipid peroxidation,and thus the accumulation of osmotic adjustment substances was improved. In general,100 μmol/L MT is considered to be the optimal concentration on improving the drought resistance of the peony seedlings. Pretreatment with exogenous MT may effectively enhance the photosynthetic fluorescence characteristics,antioxidant capacity and osmotic adjustment ability,thus promote the growth of peony seedlings under drought stress.
    Isolation,Screening and Plant Growth-promoting Potential of Nitrogen-fixing Strains from Paddy Soils
    JIN Hai-yang, WANG Hui, ZHANG Yan-hui, HU Tian-long, LIN Zhi-bin, LIU Ben-juan, LIN Xing-wu, XIE Zu-bin
    2020, 36(6):  73-82.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1020
    Asbtract ( 982 )   HTML   PDF (3836KB) ( 754 )  
    References | Related Articles | Metrics
    The aim of this study is to obtain efficient nitrogen-fixing strains and provide microbial resources for microbial regulations of biological nitrogen fixation in paddy fields. Four paddy soil samples with different nitrogen-fixing capability were selected to isolate cultivable nitrogen-fixing strains via serial dilution-plating method and enrichment procedure. Screening efficient nitrogen-fixing strains was performed by nifH gene PCR amplification,acetylene reduction activity and growth on N-free medium. Furthermore,the plant growth-promoting potentials of the efficient nitrogen-fixing strains were determined. A total of 14 cultivable microbial strains were obtained through isolation and purification. The presence of nifH gene was detected from genomic DNA of 7 newly isolated strains. Among them,the newly isolated strain P204,P205,P207 and P208 grew relatively fast and were in high acetylene reduction activity on N-free medium. Moreover,they had the plant growth-promoting potential,such as IAA production,phosphate solubilization and siderophore production. Thus,the newly isolated strains P204,P205,P207 and P208 represent potentially excellent bioresources for the future exploitation of functional genes and microbial inoculants.
    Optimization of Fermentation Conditions of Biocontrol Bacterium ML-3 Antifungal Protein and Its Application
    LI Jing-shu, ZHAO Jia
    2020, 36(6):  83-92.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1034
    Asbtract ( 585 )   HTML   PDF (3632KB) ( 439 )  
    References | Related Articles | Metrics
    In order to clarify the control effect of antifungal protein of strain ML-3 on potato early blight and to provide reference for biological control of potato early blight,the methods of ammonium sulfate fractionation,agar diffusion,orthogonal test,field test and 16S rDNA sequence analysis were used to study the optimal carbon source,nitrogen source,fermentation conditions,optimal ammonium sulfate precipitation concentration,bacteriostatic stability,field control effect and taxonomic status of strain ML-3. The results showed that the optimal composition of fermentation broth was 2% potato,1% peptone and 0.5% NaCl. The optimal fermentation conditions were initial pH 7.0,temperature 30℃,and fermentation liquid 400 mL in 500 mL Erlenmeyer flasks,inoculation volume 5 mL,and fermentation 48 h. In addition,the antifungal protein presented fine stability,when temperature ≤ 60℃,pH value from 5 to 8,and UV irradiation 36 h. The antifungal protein also had favorable stability to K+,Fe2+,Zn2+,and Na+. Besides,the concentration of antifungal protein should be ≥10 mg/L when it was used to control potato early blight in field. Strain ML-3 was identified as Bacillus subtilis subsp. inaquosorum based on 16S rRNA sequence analysis. All results indicate that the antifungal protein of strain ML-3 demonstrates obvious application potential in controlling potato early blight and the development bio-pesticide.
    Denitrification Characteristics of Aerobic Denitrifying Bacteria Achromobacter sp. L16
    LI Si-qi, YANG Jing-dan, LIU Lin, LIU Er-jia, WANG Xiao-hui
    2020, 36(6):  93-101.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0978
    Asbtract ( 767 )   HTML   PDF (3404KB) ( 1816 )  
    References | Related Articles | Metrics
    A heterotrophic nitrification-aerobic denitrification strain L16 was isolated from landfill leachate and identified as Achromobacter sp. by morphological observation and 16s rDNA gene sequence analysis. The rate of removing ammonia nitrogen was 61.94% and that of removing nitrate nitrogen was 98.40%. The culture conditions of aerobic denitrification and heterotrophic denitrification of strain L16 was optimized by single factor experiment. The optimized results of aerobic denitrification and heterotrophic nitrification of strain L16 showed that L16 was cultured with nitrate as nitrogen source,sodium citrate as carbon source,C/N 20,culture temperature 30℃,rotate speed 150 r/min,and the degradation rate of nitrate nitrogen and the rate of removing total nitrogen was 99.74% and 58.90%, respectively. Under the conditions of ammonia nitrogen as nitrogen source,sodium citrate as carbon source,C /N 20,culture temperature 30℃ and rotate speed 200 r/min,and the degradation rate of ammonia nitrogen increased to 93.41% and the removal rate of total nitrogen was 86.33%. The optimized strain L16 has high efficiency of heterotrophic nitrification-aerobic denitrification,converts the most of the nitrogen into gas and intracellular nitrogen,and thus has potential value of practical application in wastewater treatment.
    Screening of a Highly Efficient Phosphate-solubilizing Bacterium and Validation of Its Phosphate-solubilizing Effect
    TANG Min-chen, LI Wen-jing, SONG Tian-shun, XIE Jing-jing
    2020, 36(6):  102-109.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0969
    Asbtract ( 878 )   HTML   PDF (3896KB) ( 2421 )  
    References | Related Articles | Metrics
    In order to develop new,safe and highly efficient phosphate-solubilizing microbial fertilizer,several strains were isolated and screened from farmland. The strain X-P18 with the strongest phosphate-solubilizing ability was selected by validating phosphate-solubilizing effect,and was identified as Bacilus velezensis by 16S rDNA. Meanwhile,the phosphate-solubilizing mechanism of the strain was preliminarily explored by optimizing the liquid fermentation conditions and measuring the contents of low-molecular-weight organic acids in the fermentation. The phosphate-solubilizing bacterium was applied to the potted Chinese cabbage,and growth indicators of the Chinese cabbage were analyzed. The results showed that the solubilized phosphorus content in the inorganic phosphorus liquid medium by X-P18 reached 495.4 mg/L,and it characterized with secreting acetic acid and other low-molecular-weight organic acids. The X-P18 strain demonstrated the best phosphate-solubilizing ability and its effective phosphorus content reached 582.4 mg/L,which was 17.6% higher than before the optimization,when inoculation quantity was 1%,the initial pH was 8.0,the carbon source was mannose,the nitrogen source was(NH42SO4 and the culture temperature was 30℃. The growth promoting effect on Chinese cabbage was the most obvious,the fresh weight increased by 65.5%,and the total phosphorus content of leaves increased by 46.9%,when X-P18 was added in the amount of 2×109 CFU/pot.
    Isolation and Application Potential Exploration of a Diuron-degrading Bacterium
    YUE Li-xiao, LI Deng-yun, ZHANG Jing-jing, TONG Lei
    2020, 36(6):  110-119.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0778
    Asbtract ( 674 )   HTML   PDF (3717KB) ( 607 )  
    References | Related Articles | Metrics
    This work is designed to obtain soil microorganisms that can efficiently degrade diuron,to systematically elucidate the characteristics of this strain degrading diuron and its metabolic pathway,and to explore the practical application potential of the isolated strain. Sole carbon source method was applied for enrichment,domestication and isolation of diuron-degrading soil microbes. Then single factor test was used to investigate the strain’s environmental adaptability. Further mass spectrometry analysis of metabolic intermediates was to deduce the metabolic pathway of the strain degrading diuron. And simulating in situ soil remediation was to investigate the application potential of the isolated strain in soil remediation. As results,one bacterial strain LX-C-06 that effectively degraded diuron was isolated from cotton fields with long-time diuron application. The strain LX-C-06 was identified as Achromobacter xylosoxidans via morphological,physiological and biochemical characteristics and 16S rRNA gene analysis. The results of single factor tests indicated that the optimal temperature and pH for diuron degradation by strain LX-C-06 were 30℃ and 7.0,respectively. The strain LX-C-06 showed high tolerance to NaCl concentration. The degradation rates of 50 mg/L diuron within 120 h were 100%,100% and 87.8% when NaCl concentration was 1%,3% and 5%,respectively. The strain LX-C-06 also showed good degradation ability towards high concentration of diuron,and the degradation rate of the strain LX-C-06 to diuron was above 100% within 120 h when diuron concentration was ≤ 400 mg/L. The degradation rate of diuron was 92.1% within 120 h when diuron concentration increased to 600 mg/L. Based on the identification of metabolic intermediates,it was speculated that the strain LX-C-06 transformed diuron into 3,4-dichloroaniline via hydrolyzing ester bond. And 3,4-dichloroaniline was further transformed into succinic acid by deamination,hydroxylation and ring-cleavage. Within 30 d,the maximum degradation rate of 50 mg/kg diuron in soil was 90.7% with bioaugmentation of the strain LX-C-06. In conclusion,the strain LX-C-06 is identified as Achromobacter xylosoxidans that efficiently degrades diuron. The strain LX-C-06 demonstrates tolerance to environmental temperature,pH,and salinity concentration. The strain LX-C-06 transforms and utilizes diuron by hydrolyzing ester bond,deamination,hydroxylation,ring-cleavage,etc. The strain LX-C-06 also shows promising application potential.
    Isolation and Identification of Penicillium oxalicum SSCL-5 Degrading Cypermethrin and Its Biodegradation
    CHEN Rui, QU Jia, SUN Xiao-yu, DENG Yuan, MEN Xin, ZHAO Ling-xia, SHEN Wei-rong
    2020, 36(6):  120-127.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1072
    Asbtract ( 738 )   HTML   PDF (4031KB) ( 522 )  
    References | Related Articles | Metrics
    To find a solution of removing pyrethroid pesticide residues in soil,enrichment and screening methods were used,and a microbial strain,which efficiently decomposed and utilized pyrethroid-like pesticides,was isolated from over 70 soil samples,and named as SSL-5. The strain grew normally in the mineral medium containing 1 000 mg/L cypermethrin. According to the results of morphology,ITS Sequencing analysis,the strain SSCL-5 was identified as Penicillium oxalicum,and tolerant to other several pyrethroid-like pesticides in high concentration. Degradation rate of cypermethrin(400 mg/L)by this SSL-5 in the mineral medium at 28℃ and 180 r/min and culturing 24 h was verified to be 97% with HPLC and UV spectrophotometry. Laboratory soil tests proved that cypermethrin in soil(400 mg/L)was degraded by 67.6% in 30 d while temperature in 20℃-34℃ and moisture content in 40%-60%.
    Identification and Degradation Characteristics of Microbial Community Degrading Phenanthrene from Surface Sediments
    ZHANG Yong-min, WANG Tian-hui, WANG Ping
    2020, 36(6):  128-135.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1044
    Asbtract ( 560 )   HTML   PDF (3851KB) ( 438 )  
    References | Related Articles | Metrics
    A novel aerobic microbial consortium with microbial degradation was enriched and isolated from river surface sediments,and its microbial community structure was identified and its degradation characteristics were studied. The microbial community structure of the consortium was analyzed by 16S rRNA gene high throughput sequencing,and the optimal growth and degradation conditions were determined by single factor experiment. The results showed that the consortium mainly included 83.35% of Diaphobiobacter,7.46% of Pseudomonas,1.67% of Castellaellasti,1.65% of Aquamicrobium,etc. The consortium degraded > 95.78% of 100 mg/L phenanthrene in 60 h,remained its efficient degradation rate between pH5 and pH11,and optimal growth temperature was 35℃.The effect on the consortium was small,and the degradation rate was still maintained at 97.26% when the salinity was 1%. The phenanthrene with a concentration of 400 mg/L was degraded in 7 d with the degradation rate 96.36%.The consortium not only has the ability of high-efficiency degradation,but also grows in a wide range of conditions and has strong compressive ability,which may provide new germplasm resources for the bioremediation of polycyclic aromatic hydrocarbons(PAHs).
    Study on the Tolerance of Saccharomyces cerevisiae Strain to Phenolic Inhibitors
    GU Han-qi, LIU Ran, SHAO Ling-zhi, XU Yan-yan, WANG Dong-yan, ZHANG Dong-mei, LI Jie
    2020, 36(6):  136-142.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1200
    Asbtract ( 708 )   HTML   PDF (2582KB) ( 531 )  
    References | Related Articles | Metrics
    Short-term domestication strategy can be used to improve the tolerance of Saccharomyces cerevisiae to phenols produced in lignocellulose pretreatment. The inhibition of phenolic acids to the yeast strain was investigated,the physiological indexes of the domesticated strains were compared,and the membrane integrity of yeast cell was examined using the flow cytometer. The sole phenolic acid at low concentration presented insignificant inhibition on the growth and fermentation of S. cerevisiae,while significant inhibition at high concentration. Multiple phenolic acids demonstrated stronger inhibition,especially on the ethanol fermentation. Compared to the original strain,the growth and fermentation kinetic parameters of the short-term domesticated strains under mixed phenolic acid stress were significantly improved,and cell membrane remained fine integrity. Phenolic acids directly inhibited the growth of S. cerevisiae,and the short-term domestication effectively improved the tolerance of S. cerevisiae to phenolic acids,this is related to that the stress response of cell membrane remained its integrity.
    Breeding L-Glutamic Acid Producing Engineering Strain by Mutagenesis and Its Fermentation Efficiency
    LIANG Ling, HUANG Qin-geng, WENG Xue-qing, WU Song-gang, HUANG Jian-zhong
    2020, 36(6):  143-149.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0843
    Asbtract ( 839 )   HTML   PDF (2908KB) ( 574 )  
    References | Related Articles | Metrics
    The objective is to further improve the fermentation level of L-glutamic acid while taking high-yield L-glutamic acid-producing Corynebacterium glutamicum GY1 as the research object and using ARTP for global mutagenesis. First,the preparation and regeneration conditions of C. glutamicum GY1 protoplasts were optimized. Then,the optimal ARTP treatment time was selected according to the lethality rate,and then,96-microplate initial screening and shake flask fermentation screening were performed to screen mutants. Finally,the obtained fine mutant strain was subjected to fermentation in a 50 L automated fermenter. Results showed that the optimal conditions for protoplast formation and regeneration were lysozyme concentration 10.0 mg/mL and hydrolysis for 90 min. The optimal treatment time of ARTP was 40 s,and the lethal rate reached 89.6%. After initial screening and shake flask re-screening,the mutant strain YAG117 was obtained,by which the L-glutamic acid content in the shake flask fermentation was 16.3 g/L,which was 13.9% higher than the original strain,and successive 5 generations were genetically stable. Under fed-batch conditions in a 50 L automated fermenter,the concentration of L-glutamic acid was the highest at 36 h,reaching 216.6 g/L,and the glucose conversion rate was 68.87%,which was 12.9% and 10.2% higher than the original strain,respectively. In conclusion,the ARTP mutagenesis of GY1 protoplasts efficiently enriches the types of mutations,accumulates favorable mutations,and increases the ability of C. glutamicum GY1 producing L-glutamic acid. The obtained mutant strain YAG117 shows very promising potential for industrial application.
    Characterization of Rotation Speed on the Fermentation Yield of Clavulanic Acid by Transcriptome Analysis
    SONG Dao-ping, KANG Ni, ZHANG Pei-pei, ZONG Gong-li, WANG Shi-li, ZHANG Kun-yu, CAO Guang-xiang, FU Jia-fang
    2020, 36(6):  150-156.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0954
    Asbtract ( 566 )   HTML   PDF (2397KB) ( 508 )  
    References | Related Articles | Metrics
    The rotation speed affects the fermentation yield of clavulanic acid(CA). This work aims to explore the molecular mechanism of rotation speed affecting the biosynthesis of CA in Streptomyces clavuligerus F613-1. Transcriptome high-throughput sequencing was adapted to assess the differential gene expressions of CA fermentation conditions between at high rotation speed and low rotation speed,and to analyze the changes in the transcription levels of genes related to the metabolic pathway of CA. The shaking fermentation assay showed that the CA yield at high rotation speed was significantly higher than that at low rotation speed,and the fermentation period of F613-1was shortened. Transcriptome analysis demonstrated that the gene expression level of genes in CA biosynthetic gene cluster had no significant change under the condition of high rotation speed when compared with the low rotation speed. But transcriptome analysis revealed that the expression level of genes involved in metabolism of arginine and glyceraldehyde 3-phosphate(G3P),two important CA precursors,significantly increased. Therefore,the main reason for the increase of CA biosynthesis in F613-1 under the high rotation speed fermentation condition is the accumulation of CA biosynthetic precursors,arginine and G3P,and the enhancement of arginine and G3P metabolic pathways.
    Optimization of Catalytic Reaction Conditions for L-proline 4-Hydroxylase Using Response Surface Methodology
    LUO Su-ya, ZHENG Dou-dou, HE Guang-zheng, ZHANG Lin-lin, XU Shu-jing, JU Jian-song
    2020, 36(6):  157-164.  doi:10.13560/j.cnki.biotech.bull.1985-0834
    Asbtract ( 666 )   HTML   PDF (2574KB) ( 702 )  
    References | Related Articles | Metrics
    The conversion rate of L-proline 4-hydroxylase can be increased by the optimizing expression conditions and catalytic reaction conditions. The condition of optimal inducing temperature,inducer concentration,and conversion for L-proline 4-hydroxylase was screened by single factor screening,and the optimal catalytic reaction conditions were further predicted using response surface methodology. Results showed that the optimal protein expression temperature was 28℃ and the concentration of IPTG was 0.2 mmol/L. The optimal conditions for catalytic reaction were as follows:the harvested cells(1 g)were suspended in 10 mL 2-morpholinoethanesulfonic acid buffer(120 mmol/L,pH 6.6)containing 1.5% Nonidet P-40,200 mmol/L L-proline,200 mmol/L α-ketoglutarate,6 mmol/L L-ascorbate and 6.0 mmol/L ferrous sulfate,and incubated at 27℃ with shaking at 152 r/min for 48 h. Under the optimal condition,the conversion rate for trans-4-hydroxy-L-proline reached 100% after 48 h incubation. This study may provide a solid foundation for the synthesis of trans-4-hydroxy-L-proline.
    Immobilization of N-acetylneuraminic Acid Aldolaseand Properties of the Immobilized Enzyme
    WANG Hui-lan, WU Jin-yong, CHEN Xiang-song, YUAN Li-xia, ZHU Wei-wei, YAO Jian-ming
    2020, 36(6):  165-173.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1027
    Asbtract ( 748 )   HTML   PDF (4897KB) ( 561 )  
    References | Related Articles | Metrics
    N-acetylneuraminic acid aldolase(NAL)was immobilized using LX-1000HFA amino resin. The immobilized conditions were optimized,and the enzymatic properties and stabilitiesbetweenfree and immobilized enzymes were compared. The optimized conditions of immobilization were asthat the quantity of carrier was 5.0 g,the immobilization time was 12 h,the buffer concentration was 1.0 mol/L,the pH was 7.5,and the temperature was 25℃. The prepared immobilized NAL had the highest viability and the enzyme activity,reached 200 U/g wet resin. Compared with the free enzyme,the optimal reaction temperature increased by 5℃,the optimal reaction pH remainedunchanged,and thermal- and pH-tolerancewere significantly improved. Meanwhile,the storage stability and operational stability of the immobilized enzyme were also greatly enhanced. Only 6% of the enzyme activity was lost after storage for 10 d at 4℃,and the immobilized enzyme retained 80% itsactivity after repeated usage for 10 times.Therefore,the immobilized enzyme hasfine thermal stability,pH stability,storage stability,and operational stability,which provides a theoretical basis for the industrial production of N-acetylneuraminic acid via enzymatic method.
    Biological Characteristics and Antibiotic Resistance of Erysipelothrix rhusiopathiae Isolated from East China
    GONG Zheng, ZHANG Jun-jie, ZHONG Deng-ke
    2020, 36(6):  174-182.  doi:10.13560/j.cnki.biotech.bull.1985.2020-0337
    Asbtract ( 721 )   HTML   PDF (2087KB) ( 646 )  
    References | Related Articles | Metrics
    The aim of this study is to investigate the biological characteristics of Erysipelothrix rhusiopathiae originated from pig farms in East China and its resistance to common clinical antibiotics. A total of 266 samples of pigs suspected to be infected by E. rhusiopathiae in pig farms of East China during 2017-2018 were collected and isolated,their biochemical characteristics,serotypes,mouse pathogenicity and other biological properties of the isolates were analyzed,and their 16S rDNA sequences and drug sensitivity were determined. As results,20 E. rhusiopathiae strains were isolated and identified,all of them were classified into serotype 1a in serum type,and an led to 100% mortality in challenged mice,i.e.,they had the biochemical characteristics of E. rhusiopathiae. The homology of 16S rDNA sequence with domestic reference strains and other clinical strains of E. rhusiopathiae was > 99%. Using challenge with lethal dose of 5 field strains of E. rhusiopathiae by intraperitoneal inoculation,mice immunized with commercial attenuated vaccine of E. rhusiopathiae were 100% protected from the challenge. All isolated strains were sensitive to penicillin,ampicillin,erythromycin,tilmicosin,ceftriaxone,ceftiofur and florfenicol. However,there were multi-drug resistances to lincomamides,quinolones,aminoglycosides,tetracyclines,sulfonamides,and polypeptides at varied levels. In conclusion,this study clarified the biological characteristics and antibiotic resistance of E. rhusiopathiae in East China,and the current commercial attenuated vaccine of E. rhusiopathiae can completely protect the pigs from challenges with the tested strains,which provides data for the effective prevention and control of swine erysipelas in clinical practice.
    Analysis of Genetic Diversity and Genetic Structure in 7 Local Goat Breeds
    ZHANG Le-chao, LIU Yue-qin, DUAN Chun-hui, ZHANG Ying-jie, WANG Yong, GUO Yun-xia
    2020, 36(6):  183-190.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1069
    Asbtract ( 847 )   HTML   PDF (2423KB) ( 610 )  
    References | Related Articles | Metrics
    Total 15 SSR sites were selected to examine the genetic diversity and genetic structure of 7 local goat breeds,which provides the basis of protection and utilization of the local goat breeds. Blood samples of Yanshan cashmere goats,Liaoning cashmere goats,Chengde polled goats,Jining gray goats,Taihang goats,Wu’an goats and ear tissues of Inner Mongolia cashmere goats were collected to investigate genetic diversity and genetic structure with microsatellite marker method. The average number of effective alleles,average expected heterozygosity and average polymorphism information content of the seven goat populations were 4.235 8,0.718 8 and 0.706 8,respectively,indicating that these seven goat breeds had high genetic diversity. The Fit(population inbreeding number)was 0.0883,average Fst(coefficient of gene differentiation among populations)was 0.544 2 and average Nm(gene flow)was 0.209 4. The genetic distance between Wu’an goat and Chengde polled goat was the closest,and that between Taihang goat and Yanshan cashmere goat was the longest. UPGMA analysis showed that Yanshan cashmere goats and Liaoning cashmere goats clustered in one,as well as Jining gray goats,Chengde polled goats,Wu’an goats,Inner Mongolia cashmere goats and Taihang goats clustered in one. In sum,the genetic diversity is abundant in seven local goats with high degree of genetic differentiation. There is a little gene exchange and the influence of inbreeding is small. The results indicate the utilization value and potential are high in seven local goat breeds.
    Changes in Plasma Metabolites After Calving in Dairy Cows
    ZHANG Meng, LUO Fang, WANG Min, WU Yan-ze, WANG Jun-kui, HE Dong-qian, CHEN Li-yao, TAO Jin-zhong
    2020, 36(6):  191-199.  doi:10.13560/j.cnki.biotech.bull.1985.2019-1065
    Asbtract ( 656 )   HTML   PDF (7810KB) ( 158 )  
    References | Related Articles | Metrics
    This work aims to study the changes of plasma metabolites in dairy cows in the calving and postpartum period. Fifteen healthy and high-yield dairy cows with similar parity,expected date of birth and similar body conditions were selected for collecting 10 mL blood from the tail vein on the day of calving and on the 7th day after calving when before morning feeding. The blood plasma of the cows was analyzed by ultra-high performance liquid chromatography-quadrupole-time-of-fight-mass spectrometry(UHPLC-QTOF-MS). Combined with principal component analysis(PCA)and orthogonal partial least squares-discriminant analysis(OPLS-DA),plasma differential metabolites between 2 groups were screened based on the P<0.05,VIP>1 and FC>1.3 or FC<0.77. The ROC curve further was used to study the ability of these significant differential metabolites to be classified and identified. The results showed that 11 significant up-regulated differential metabolites were found by ROC curve:PC(16:0/16:0),glycolithocholic acid,pro-ser,pro-gly,L-stearoyl-sn-glycerol 3-phosphocholine,orotic acid,L-aspartate,N-acetyl-L-aspartic acid,isovalerylglycine,L-calving-carnitine and benzoic acid. There were significant differences in the metabolic profiles of alanine,aspartic acid and glutamic acid metabolism,glycerophospholipid metabolism and pyrimidine metabolism between the day of calving and on the 7th day after calving. In summary,the changes of N-acetyl-L-aspartic acid,L-aspartic acid,PC(16:0/16:0)and orotic acid are beneficial to maintain the health of cows after postpartum period.
    Cloning and Tissue Expression Analysis of CSRP3 in Yak
    BAI Jia-ling, WANG Hui, CHAI Zhi-xin, WANG Ji-kun, WANG Jia-bo, WU Zhi-juan, XIN Jin-wei, ZHONG Jin-cheng, CHEN Zhi-hua, JI Qiu-mei
    2020, 36(6):  200-207.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0873
    Asbtract ( 817 )   HTML   PDF (4046KB) ( 584 )  
    References | Related Articles | Metrics
    The CSRP3 gene(cysteine and glycine-rich protein 3)encodes CRP3 protein,which is a positive regulator of myogenesis and plays an important role in muscle development and structural maintenance of muscle cells. Through cloning and tissue expression profile analysis of yak CSRP3 gene,the basic data may be provided for the further study of improving yak meat quality. The CDS region of yak CSRP3 gene was cloned by RT-PCR and analyzed by bioinformatics of sequence analysis,protein structure and function prediction. Finally,the expression of the gene in yak tissues was detected by qPCR. The results showed that the CDS region length of CSRP3 gene in yak was 585 bp,and a total of 194 amino acids were encoded. The phylogenetic tree demonstrated that yak had the closest relationship with cattle,followed by sheep. The protein encoded by CSRP3 gene was an alkaline unstable hydrophilic protein without transmembrane structure and signal peptide,not a secretory protein. There were 22 phosphorylation sites,2 N-glycosylation sites,7 O-glycosylation sites and 2 LIM domains,and it belonged to the superfamily member of LIM structure domain protein. The protein was mainly distributed in the nucleus. The secondary structure was mainly composed of random coils. The best model of the tertiary structure was 1b8t.1.A. The bioinformatics analysis revealed that the CRP3 protein contained 2 LIM domains and mainly distributed in the nucleus. The qPCR results showed that the yak CSRP3 gene had higher expression in the gluteus maximus. These results provide basic data for the research on whether the CSRP3 gene may improve the quality of yak meat.
    The Study on the Adsorption Properties of Six Proteins on Biological Magnetic Nanobeads
    WANG Meng-hui, GAO Ying, LI Jia-huang, HUA Zi-chun
    2020, 36(6):  208-214.  doi:10.13560/j.cnki.biotech.bull.1985.2020-0032
    Asbtract ( 1179 )   HTML   PDF (2962KB) ( 717 )  
    References | Related Articles | Metrics
    In recent years,magnetic nanobeads have received extensive attentions in the fields of biotechnology and biomedicine;however,there is often non-specific adsorption between proteins and biological magnetic nanobeads. Therefore,the relationship between the structure and physicochemical properties of proteins and magnetic bead adsorption was studied from the perspective of proteins. Using two types of biological magnetic nanobeads,the adsorption specificities of 6 different proteins on the surfaces of magnetic beads were studied. Each protein’s structure was analyzed by protein analysis software,and the structure and physicochemical property of different proteins were obtained. The relationship between protein properties and the adsorption specificity of the magnetic bead was analyzed. There was non-specific adsorption for different proteins on the surfaces of magnetic nanobeads,and the size of the protein was not significantly related to the ability of magnetic beads to adsorb proteins. As the β-sheet ratio of protein decreased,the non-specific adsorption of protein on the surfaces of magnetic beads also decreased. Human Tumor Necrosis Factor alpha(TNFα)with the largest β-sheet ratio had the most non-specific adsorption on the magnetic beads,and a single protein band was obtained by the adsorption. Human Annexin A5 with the smallest β-sheet ratio had the least non-specific adsorption on the magnetic beads. After Annexin A5 was fused with Enhanced Green Fluorescent Protein(EGFP),the β-sheet ratio was increased,and the non-specific adsorption by magnetic beads also increased. In conclusion,there is no obvious correlation between the protein size and the non-specific adsorption on the surfaces of magnetic beads. The non-specific adsorption capacity of magnetic beads to proteins is positively related to the β-sheet ratio of the protein structure. Protein secondary structure is an important factor for the non-specific adsorption of proteins to magnetic beads.
    Research Progress on Plant Allelopathy
    SHI Xiao-ping, CHEN Yin-ping, YAN Zhi-qiang, LUO Yong-qing, LI Yu-qiang, DING Jun-gang, XIE Hai-fan
    2020, 36(6):  215-222.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0930
    Asbtract ( 1403 )   HTML   PDF (1104KB) ( 4890 )  
    References | Related Articles | Metrics
    Allelopathy is a phenomenon that plants interact with each other,which widely exists in nature. Allelopathy plays an important role in the succession of natural vegetation and human production activities,thus it is a hot issue in studying farmland,grassland,forest and desert ecosystems. This paper summarizes the recent research results of allelopathy by scholars at home and abroad,introduces the development history of allelopathy,classification and release ways of allelochemicals,sum up the mechanism of allelopathy in detail,and expounds the research significance and practical application of allelopathy from three aspects of agricultural activities,vegetation succession and grass production. On this basis,the paper discusses existing issues in this field,and prospects the future research direction.
    Research Progress on Plant ABCB Transporter
    WANG Xuan, CHEN Hai-xia
    2020, 36(6):  223-229.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0899
    Asbtract ( 1478 )   HTML   PDF (2829KB) ( 3533 )  
    References | Related Articles | Metrics
    ABC transporter family is a transport protein that binds and hydrolyzes ATP to release energy to realize the transmembrane transport of substrates.They are involved in many physiological and metabolic processes in plants.The ABC transporter family is divided into 8 subgroups according to the evolutionary relationship of conserved regions,among which ABCB transporter is the second largest subgroup.The conserved NBDs domain of ABCB transporter and the hydrophobic transmembrane domain of 6 transmembrane alpha-helices form the TMDs domain,thus the solute transmembrane channel is formed,while its structure,length and sequence vary. Plant ABCB transporters can be divided into whole molecule transporters and half molecule transporters. Through sequencing,ABCB transporter is found in arabidopsis thaliana,rice,tomato and other plants,and performs various functions. Studies have shown that ABCB transporter gene mediates the transport of heavy metal ions such as cadmium,lead and aluminum,and increases the tolerance of heavy metal in plants. It is directly involved in the transport of auxin in plants,thus regulating plant height. It may also transport malic acid from plasmids to guard cells to regulate stomatal opening and closing.In recent years,more and more ABCB transporters have been identified,but the ABCB subfamily is large,the substrate specificity is strong,the transport mechanism is complex,and the functions of most transporters have not been determined.Therefore,to understand the importance of ABCB transporter in the process of life activities and the mechanism of gene expression and regulation,and to analyze the important role of ABCB transporter in the process of responding to adversity and stress,may provide ideas for plant stress resistance breeding.
    Effects of ANGPTL4 on Intestinal Microbiota Affecting Lipid Metabolism of Animals
    ZHAO Xu, XU Qun, HOU Yan-ru, LI Ming-yu, ZHANG Ya-ning, WANG Hai
    2020, 36(6):  230-235.  doi:10.13560/j.cnki.biotech.bull.1985.2020-0028
    Asbtract ( 717 )   HTML   PDF (1091KB) ( 900 )  
    References | Related Articles | Metrics
    Angiopoietin-like protein 4(ANGPTL4)is a protein that is closely related to animal lipid metabolism and widely expressed in many tissues of animals. It is recognized as an important medium to communicate intestinal microbiota and host lipid metabolism. This article summarizes the relationship between gut microbes and host fat deposition,the effect of gut microbes on host ANGPTL4,the role of ANGPTL4 on animal lipid metabolism,and the relationship among gut microbes,ANGPTL4 and animal lipid metabolism. Also this article discusses the significance and existing issues in studying intestinal microbiota affecting lipid metabolism of animals via ANGPTL4,aiming at providing a better explanation for the effects of feed additives such as probiotics and acidifiers on fat deposition and production performance of livestock and poultry.
    Research Progress and Prospects of Adiponectin and Its Receptor in Mammal
    ZHANG De-rong, MA Xiao-xia, LI Yu-fei, ZHAO Yong-qing, HUO Sheng-dong, MA Zhong-ren, BAI Jia-lin
    2020, 36(6):  236-244.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0829
    Asbtract ( 729 )   HTML   PDF (1800KB) ( 1557 )  
    References | Related Articles | Metrics
    As an endogenous cytokine secreted from adipose tissue,adiponectin plays an importantly biological role in regulating energy homeostasis,glucose metabolism,fatty acid oxidation,anti-inflammatory,and development of insulin resistance via its receptor’s effects. In order to provide some theory basis and new ideas for molecular breeding in mammal. This review focuses on the structural characteristics,expression regulation and polymorphism of adiponectin and its receptors,on how to improve mammal’s growth and reproductive performance,and on how to reduce fat deposition in mammals and so on.
    Research Progress on Functional Nucleic Acid Biosensors Mediated by DNA/Silver Nanoclusters
    YANG Min, LI Shu-ting, YANG Wen-ping, LI Xiang-yang, XU Wen-tao
    2020, 36(6):  245-254.  doi:10.13560/j.cnki.biotech.bull.1985.2019-0963
    Asbtract ( 759 )   HTML   PDF (1459KB) ( 871 )  
    References | Related Articles | Metrics
    DNA/Silver nanocluster(DNA/Ag NCs)is a novel fluorescent nanomaterial produced by using DNA as a template and NaBH4 and silver ions as reactants. In recent years,silver nanoclusters have become a hotspot in the design and applications of biological sensors due to their excellent photophysical properties,fine biocompatibility,low cost and low toxicity. The signal output methods in DNA/silver nanocluster-mediated biosensor are categorized,and the applications of DNA/Ag NCs in vivo imaging and bacteriostasis are also summarized. Finally,the shortcomings of DNA/Ag NCs-mediated biosensors and their future development trends are prospected.
    Others
    Content
    2020, 36(6):  255-258. 
    Asbtract ( 185 )   HTML   PDF (322KB) ( 233 )  
    Related Articles | Metrics
    Cover
    2020, 36(6):  259-259. 
    Asbtract ( 161 )   HTML   PDF (2502KB) ( 150 )  
    Related Articles | Metrics